ID: 1049185846

View in Genome Browser
Species Human (GRCh38)
Location 8:141252744-141252766
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 2, 1: 1, 2: 0, 3: 7, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049185846 Original CRISPR GGAAATTCACAGACGCAGGT GGG (reversed) Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
902987873 1:20166423-20166445 GGATCTTCACAGAGGCAGGAGGG - Intronic
903757511 1:25672842-25672864 GGAAAGTCCAAGAGGCAGGTAGG + Intronic
903858704 1:26352666-26352688 GGATAATGACAGACTCAGGTGGG - Intronic
908387633 1:63657669-63657691 TCAAATTCACAGACACAGGAAGG - Intronic
911761562 1:101623189-101623211 AGAAATTCACAGATCCTGGTGGG + Intergenic
914431323 1:147622296-147622318 GGATATTCACAGAGGCAGGCTGG - Exonic
914913515 1:151804573-151804595 GGAAACTCACAGGAGCAGGAAGG - Intronic
915687263 1:157645893-157645915 GGAATTTCACGGAGGCAGGAAGG + Intergenic
916678122 1:167081400-167081422 GGCAGTTCACACACGCAGGTTGG + Intronic
920764826 1:208822079-208822101 TGTATTTCACAGAAGCAGGTTGG - Intergenic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
1063214730 10:3913770-3913792 AGATTTTCACAGCCGCAGGTAGG + Intergenic
1064520032 10:16191119-16191141 GGAAATACCCTGACGCAGCTGGG - Intergenic
1065884314 10:30063311-30063333 GGGATTTCACAGACTCAGGAAGG + Intronic
1066397502 10:35040622-35040644 GCAAAGTCACAGACTCAGGTCGG + Intronic
1067237584 10:44464266-44464288 TCAAATTCACAGATGCAGGAAGG - Intergenic
1067510711 10:46892864-46892886 GGAAATTCATAGAAGCAGATTGG - Intergenic
1067651544 10:48158998-48159020 GGAAATTCATAGAAGCAGATTGG + Intronic
1073929170 10:108554805-108554827 GGAAATTCACAGAAACTTGTTGG + Intergenic
1074280820 10:112049961-112049983 GGAAATTCACAGACAGTGGGTGG - Intergenic
1081884507 11:46483445-46483467 GGAAATTAACAACCACAGGTTGG + Intronic
1085949551 11:81313200-81313222 GGAAGTTCACAGACAGAGGATGG + Intergenic
1086807317 11:91260719-91260741 GGAAATTTGCAGAGGCAGTTTGG - Intergenic
1089221187 11:116873376-116873398 GGAAATTCAGACATGTAGGTTGG + Intronic
1093084066 12:14847377-14847399 GGAAATTCACAGAGGAGTGTTGG - Intronic
1093137833 12:15473222-15473244 GCAAACTCACAGACACAGTTAGG - Intronic
1096267235 12:50133627-50133649 TGAAATCCACTGAAGCAGGTAGG + Intronic
1098262812 12:68687905-68687927 GGAGACACACAGATGCAGGTTGG - Intronic
1098286213 12:68909428-68909450 GGAAATACACATACTCACGTGGG + Intronic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1111051661 13:82890171-82890193 AGGAATACACAGACGGAGGTAGG - Intergenic
1112585031 13:100711520-100711542 GGAAATTCCCAGAAGCATGTAGG - Intergenic
1114320968 14:21546903-21546925 GAAAAGTCACAGACACAGGCCGG - Intergenic
1118972187 14:70646208-70646230 GGAAATTCAAAGAAATAGGTAGG + Intronic
1119682286 14:76601856-76601878 GGAATGTCACATACACAGGTAGG + Intergenic
1121873789 14:97432799-97432821 GTGATTTCACAGAAGCAGGTGGG + Intergenic
1122938163 14:104969455-104969477 GCAAATTCACAGACTGAGCTTGG + Intronic
1202850021 14_GL000225v1_random:10302-10324 GGAATTTCACAGACGGAGAAGGG - Intergenic
1202892378 14_KI270722v1_random:170415-170437 GGTACTCCACAGATGCAGGTCGG - Intergenic
1129078572 15:73019614-73019636 GGAAATCCCCAAACGCTGGTGGG + Intergenic
1140317924 16:73917389-73917411 GGAAATTCACAGCCAGAGGAGGG + Intergenic
1141705060 16:85660209-85660231 GGGAATTCACGCAAGCAGGTGGG + Intronic
1142513569 17:412979-413001 GCAAAATCACACAGGCAGGTGGG + Intronic
1143859338 17:9876674-9876696 AGAAAATCACAGAAGCAGGAAGG - Intronic
1146913786 17:36665211-36665233 AGAAGTTGACAGAGGCAGGTGGG + Intergenic
1147193856 17:38752268-38752290 GGAAATTTAATGATGCAGGTGGG - Intergenic
1150466716 17:65399504-65399526 GGAAATTCATTGACGAAGATGGG - Intergenic
1151231247 17:72686629-72686651 GGGCATTCACAGCAGCAGGTTGG - Intronic
1151447938 17:74179398-74179420 GGAAACACACAGACACAGGAAGG + Intergenic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152333781 17:79688582-79688604 GGAAATTCTCAAACCCAGGAAGG + Intergenic
1155540128 18:26861414-26861436 GGAAATTCTCAGTTGAAGGTGGG - Intronic
1160897796 19:1410862-1410884 GGAAAGTCACAGAGGGAGGAAGG + Intronic
1161055061 19:2186781-2186803 TGAAATCCACAGCAGCAGGTCGG - Intronic
1164987527 19:32659376-32659398 AGAAATTGCCAGATGCAGGTCGG - Intronic
1165813749 19:38628369-38628391 GGAAACTCACAGAGGGAGGAGGG - Intronic
1165919516 19:39286331-39286353 GGAAATTCATAGAGGCAGAAAGG - Intergenic
926587498 2:14704246-14704268 AGAAATTCAATGACGCACGTTGG + Intergenic
926693886 2:15757143-15757165 GTAAATCCACAAAAGCAGGTTGG + Intergenic
929035814 2:37690578-37690600 AGAAATTCAGACAAGCAGGTGGG - Intronic
937337216 2:121069368-121069390 GGAATTCTACAGACCCAGGTGGG + Intergenic
939451419 2:142379655-142379677 AGAAATTTACAGACTGAGGTAGG + Intergenic
940034115 2:149295366-149295388 AGAAAATCACAGAAGCAGGAAGG - Intergenic
947184396 2:227442045-227442067 CAAAATTCACAGATACAGGTCGG - Intergenic
948584227 2:239009014-239009036 GGAAAATCACAGATGGAGGAAGG - Intergenic
1168844835 20:937015-937037 GGAAATTCACTGATGTAGTTTGG + Intergenic
1169960966 20:11159689-11159711 GGAAATTGAGAGGAGCAGGTTGG - Intergenic
1170031284 20:11946901-11946923 GGAAATTCTCAGACACCTGTTGG - Intergenic
1172264686 20:33600787-33600809 GGAAGTTCAGAGATGAAGGTAGG - Intronic
1174496537 20:50948176-50948198 GGAAATTCCCAGTCAGAGGTAGG - Intronic
1174669620 20:52294274-52294296 GGAAATACCCAGAAGAAGGTGGG + Intergenic
1176418845 21:6498719-6498741 GGACATTCACAGCCGAAAGTTGG + Intergenic
1176669779 21:9722441-9722463 AGAAAACCACAGACGCAGGAAGG + Intergenic
1178787932 21:35671739-35671761 GGAAACTCACAGAATCAGGAGGG + Intronic
1179483721 21:41695101-41695123 GGAAAATCATAGAGGCAGGCAGG - Intergenic
1179694339 21:43107041-43107063 GGACATTCACAGCCGAAAGTTGG + Intronic
1181640924 22:24198005-24198027 AGAAATTCACAGAAGTAGATTGG + Intergenic
1182168638 22:28203708-28203730 GTTAATCCACAGAGGCAGGTGGG - Intronic
1183548390 22:38467611-38467633 CCAAATTAACAGACGGAGGTGGG + Intergenic
1185135395 22:49068737-49068759 GGGAATTCACAGAGGCAGGACGG - Intergenic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950682651 3:14595695-14595717 GGAGATGCACACACGCAGGGAGG + Intergenic
954771958 3:52978902-52978924 GCAAATTCACAGAGACAAGTGGG + Intronic
955404443 3:58617165-58617187 GGACCTTCACAGACGCTGGCCGG + Intronic
960336861 3:116428117-116428139 GGAAATTCACATAAGAAGGCTGG - Intronic
967443922 3:189542643-189542665 CAAAATTGACAGACTCAGGTTGG + Intergenic
971016809 4:22497412-22497434 AGAAATTCAGAGAAGCAGGCTGG + Intronic
973729820 4:53812254-53812276 GGAAGTTCAAAAAGGCAGGTTGG + Intronic
991115496 5:62949967-62949989 GGAAATTCACTGACACTGTTTGG - Intergenic
994788716 5:104197141-104197163 GGAGATACACAGGGGCAGGTTGG + Intergenic
996580845 5:125030438-125030460 GTACATTCACAGAGGCAGGAAGG + Intergenic
1010285276 6:74070096-74070118 GGAAAAACACAAAGGCAGGTTGG + Intergenic
1020088118 7:5322586-5322608 GGAAAGTCTCAGAGGTAGGTGGG - Intronic
1025206190 7:56994539-56994561 GGAAAGTCTCAGAGGTAGGTGGG + Intergenic
1025665749 7:63582400-63582422 GGAAAGTCTCAGAGGTAGGTGGG - Intergenic
1029342356 7:99955512-99955534 GGAAAAGCACAGACACAGGCAGG - Intergenic
1029347402 7:99988382-99988404 GGAAAAGCACAGACACAGGCAGG - Intergenic
1030090264 7:105852075-105852097 GGAACTTCACAGAGGGAGGATGG - Intronic
1033357285 7:140610399-140610421 GGTAATTCACAGACGTAATTGGG - Intronic
1035770628 8:2143814-2143836 GCACCTTCACACACGCAGGTAGG - Intronic
1040630962 8:49209841-49209863 GGGAATTTACATACCCAGGTTGG + Intergenic
1043490508 8:80743518-80743540 GGATGTTCAGAGAAGCAGGTGGG + Intronic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048719413 8:137306143-137306165 TGAAATTCACAATCACAGGTGGG + Intergenic
1049185828 8:141252570-141252592 GGAAATTCACAGACACTCGCAGG - Intronic
1049185834 8:141252640-141252662 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185846 8:141252744-141252766 GGAAATTCACAGACGCAGGTGGG - Intronic
1049185860 8:141252852-141252874 AGAAATTCACAGACACGGGCAGG - Intronic
1049185878 8:141253030-141253052 GGAAATTCACAGACACAGGTGGG - Intronic
1049185884 8:141253068-141253090 GGAAATTCACAGACACTCGCAGG - Intronic
1049185888 8:141253106-141253128 GGAAATTCACAGACACTCGCAGG - Intronic
1049185910 8:141253288-141253310 AGAAATTCACAGACACACGCAGG - Intronic
1051128197 9:13829397-13829419 TCAAATTCACAGACGAATGTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060005263 9:119993995-119994017 GGTAATTCAAAGACCCAGGAGGG - Intergenic
1186729440 X:12392720-12392742 GAAAATTCACAGACATAGGAAGG - Intronic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1192789974 X:74371942-74371964 GGAAATAGACTGAAGCAGGTAGG - Intergenic
1194491269 X:94552547-94552569 GGAAAATCACAGAAGCAGCAAGG - Intergenic
1195156358 X:102127068-102127090 GGAAAGTCAGAGATGCAGGGAGG + Exonic
1198520605 X:137448816-137448838 GGACATGCAGGGACGCAGGTGGG - Intergenic
1201395590 Y:13544322-13544344 GGTAATTCATAGAGGCAGCTAGG + Intergenic