ID: 1049187854

View in Genome Browser
Species Human (GRCh38)
Location 8:141268058-141268080
Sequence TCACCTACACAAGGACGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 0, 2: 14, 3: 267, 4: 717}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049187854_1049187857 8 Left 1049187854 8:141268058-141268080 CCAAGACGTCCTTGTGTAGGTGA 0: 1
1: 0
2: 14
3: 267
4: 717
Right 1049187857 8:141268089-141268111 ACCGTGGAACATCCAGATGATGG No data
1049187854_1049187860 30 Left 1049187854 8:141268058-141268080 CCAAGACGTCCTTGTGTAGGTGA 0: 1
1: 0
2: 14
3: 267
4: 717
Right 1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG No data
1049187854_1049187856 -8 Left 1049187854 8:141268058-141268080 CCAAGACGTCCTTGTGTAGGTGA 0: 1
1: 0
2: 14
3: 267
4: 717
Right 1049187856 8:141268073-141268095 GTAGGTGACTGAATAAACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049187854 Original CRISPR TCACCTACACAAGGACGTCT TGG (reversed) Intronic
900079623 1:846057-846079 TCATCTACTGAAGGACATCTTGG - Intergenic
900750469 1:4393592-4393614 TCACCTACTGAAGGACATCTTGG - Intergenic
901188844 1:7391905-7391927 TCACCTATTGAAGGATGTCTGGG + Intronic
901373934 1:8823977-8823999 TCACCTAATGAAGGACATCTTGG - Intergenic
901477146 1:9497509-9497531 TCACCTACTGGAGGACATCTTGG + Intergenic
901843026 1:11965551-11965573 CCACCTGCACAACGACCTCTGGG + Exonic
902945010 1:19829305-19829327 TCACCTACTAAAGGACATCTTGG + Intergenic
903452078 1:23460809-23460831 TCACCTACTGAAGGACATCTTGG - Intronic
903685056 1:25125200-25125222 TCACCTACTCCATGAAGTCTAGG - Intergenic
904339129 1:29822156-29822178 TCACCTACTGAAGGACATCTGGG + Intergenic
904802947 1:33108765-33108787 TCACCTACTGAAGGACATCTTGG + Intronic
904854062 1:33482467-33482489 TCACCTACTGAAGGACATCTTGG + Intronic
905114942 1:35630434-35630456 TCACCTACTGAAGGACATCTTGG - Intronic
905681019 1:39870884-39870906 TCACCTATTAAAGGACATCTGGG - Intronic
906394471 1:45449443-45449465 TCACCTATTGAAGGACATCTTGG - Intronic
906452794 1:45966257-45966279 TCACCTACTGAAGGGCATCTTGG + Intronic
907817034 1:57928846-57928868 TCACCAACTGAAGGACATCTTGG + Intronic
908188191 1:61672751-61672773 TCACCTACTGAAGGACATCTTGG - Intergenic
908328573 1:63048171-63048193 TCACTTACTAAAGGACATCTTGG - Intergenic
908516895 1:64901894-64901916 TCACCTACACAATGTCCTCAGGG + Intronic
908674973 1:66593188-66593210 TCACCTACTGAAGGACATCATGG + Intronic
908695972 1:66842217-66842239 TCACCTACTGAAGGGCATCTTGG + Intronic
908875521 1:68670067-68670089 TCACCTACAGAAGGACATCTGGG + Intergenic
909102585 1:71367955-71367977 TCACCTACTGAAGGACATCTTGG + Intergenic
909111631 1:71485832-71485854 TCACCTACTGAAAGACATCTTGG + Intronic
909645635 1:77913834-77913856 TCACCTACCAAATGACATCTTGG - Intronic
909911370 1:81261677-81261699 TCACCTATTGAAGGACATCTTGG - Intergenic
909965795 1:81908488-81908510 GCACCTACAGAAGGACATATAGG + Intronic
910067053 1:83166748-83166770 TCACCTACTGAAGGACATCTTGG + Intergenic
910150438 1:84136777-84136799 TCACCTACTGAAGGACATTTTGG - Intronic
910189237 1:84577913-84577935 TCACCTACTGAAGGACATCTTGG + Intergenic
910273456 1:85421830-85421852 TCACATATAGAAGGACATCTTGG + Intronic
910412399 1:86961015-86961037 TAACCTACTGAAGGACATCTTGG - Intronic
910570355 1:88694513-88694535 TCACCTACTGAAGGACATCTTGG + Intronic
910732187 1:90410134-90410156 TCACCTGCTAAAGGACATCTTGG + Intergenic
910978252 1:92931205-92931227 CCACCTACTGAAGGACATCTTGG - Intronic
911224041 1:95284798-95284820 TCATCTGCACAAGGAAGTCCTGG + Intergenic
911351116 1:96756539-96756561 TCACCTCCTAAAGGACTTCTTGG - Intronic
911361720 1:96884972-96884994 TCACCTACTAAAGGACATCTTGG - Intergenic
911442229 1:97941205-97941227 TCACCTACCAAAAGACATCTTGG + Intergenic
912065663 1:105738128-105738150 TCACCTATTCAAGGACCACTTGG + Intergenic
912479578 1:109970981-109971003 TCGCCTACTGAAGGACATCTTGG - Intergenic
913028054 1:114866078-114866100 TCACTTACTAAAGGACATCTTGG + Intronic
913204581 1:116525428-116525450 TCACTTACTGAAGGACATCTTGG + Intronic
913237134 1:116795074-116795096 TCACCTACTGAAGGATATCTTGG + Intergenic
913327893 1:117643522-117643544 TCACCTACTGAAGGACATCTTGG + Intergenic
913365912 1:118038517-118038539 CCACCTACTGAAGGACATCTTGG - Intronic
913462877 1:119106705-119106727 TCACCTACTAAAAGACATCTTGG + Intronic
913665057 1:121040474-121040496 TCACCTACTGAAGGACATCTTGG - Intergenic
914016448 1:143823748-143823770 TCACCTACTGAAGGACATCTTGG - Intergenic
914077899 1:144373838-144373860 TCACCTATTGAAGGACATCTTGG + Intergenic
914101280 1:144592667-144592689 TCACCTATTGAAGGACATCTTGG - Intergenic
914161335 1:145137253-145137275 TCACCTACTGAAGGACATCTTGG + Intergenic
914172808 1:145242378-145242400 TCACCTATTGAAGGACATCTTGG + Intergenic
914655066 1:149732289-149732311 TCACCTACTGAAGGACATCTTGG - Intergenic
915808864 1:158885467-158885489 TCAAATAAACAAGGAAGTCTTGG + Intergenic
915934015 1:160079873-160079895 TTACCTACTGAAGGACATCTCGG - Intergenic
916191009 1:162178243-162178265 TCACCTACTGAAGGACATTTTGG + Intronic
916720088 1:167478245-167478267 TAACCTGCCCAAGGAAGTCTGGG - Intronic
916755394 1:167764736-167764758 TCACCTACTGAAGGACTTCTTGG - Intronic
917263261 1:173192312-173192334 TCACCTACTGAAGGACGTTTTGG - Intronic
917849079 1:179044694-179044716 TCACTTACTGAAGGACATCTTGG + Intronic
918051894 1:180980778-180980800 TTACCTACTGAAGGACGCCTTGG - Intronic
918486140 1:185030369-185030391 TTACCTACTGAAGGACATCTTGG - Intergenic
918776905 1:188643835-188643857 TCACCCACTGAAGGACATCTTGG + Intergenic
919075010 1:192802813-192802835 TCACCTACTGAAGGACATCTTGG - Intergenic
920507698 1:206528084-206528106 TCACTTACTGAAGGACATCTTGG - Intronic
920890699 1:209982590-209982612 TCACCTACAGAGGGACATCTTGG + Intronic
921014898 1:211180316-211180338 TCACCTACTAAAGGACATATTGG + Intergenic
921093060 1:211861361-211861383 TCACCTACCAAAAGACATCTTGG + Intergenic
921113635 1:212064677-212064699 TCACCTACTGAAGGACATCTTGG + Intronic
921249130 1:213280105-213280127 CCACCGACACAAGGACTCCTGGG - Intergenic
921536776 1:216360155-216360177 TCACCTACTGAAGGACATCTTGG - Intronic
921582454 1:216911220-216911242 TCACTTACTGAAGGACATCTTGG - Intronic
921627262 1:217390602-217390624 TCACCTAGGGAAGGACATCTTGG - Intergenic
921790815 1:219288213-219288235 TCACCTACTGAAGAACATCTTGG - Intergenic
921914734 1:220594619-220594641 TCACCTACTGAAGGACGTCTTGG - Intronic
922069859 1:222181290-222181312 TCACCTACTGATGGACATCTTGG - Intergenic
922181374 1:223235759-223235781 TCACCTACTGAAGGACATCTTGG + Intronic
922637424 1:227188477-227188499 TTACCTACTTAAGGACATCTTGG - Intronic
922951934 1:229565738-229565760 TCACCGACTGAAGGACATCTTGG + Intergenic
922997784 1:229980163-229980185 TCACCTTCTAAAGGACATCTTGG - Intergenic
923022949 1:230179195-230179217 TCACCTAGTGAAGGACATCTTGG + Intronic
923232670 1:232002472-232002494 TCACCCACAGAAAGACATCTCGG - Intronic
923428969 1:233902102-233902124 TCAGCTACTGAAGGACATCTTGG + Intergenic
923487828 1:234452804-234452826 TCACCTACTGAAGGACATCTTGG - Intronic
923549680 1:234953538-234953560 TCACCTACTAAAGGACATCTTGG + Intergenic
923627472 1:235625830-235625852 TCACCTACTGAAGAACATCTTGG + Intronic
923717723 1:236439246-236439268 TCACCTACTGAAGGATGTCTTGG + Intronic
923808987 1:237291534-237291556 TCACCTACTGATGGACATCTTGG - Intronic
923857544 1:237861273-237861295 TCACCTACTGAAGGACATCTTGG - Intergenic
923908623 1:238414325-238414347 TCACCTACTAAAGGACATCTTGG - Intergenic
923961942 1:239095405-239095427 TCACCTACTGAAGGACATCTTGG - Intergenic
924020848 1:239780023-239780045 TCACCTACTGGAGGACATCTTGG + Intronic
924124448 1:240835683-240835705 TCACCTACTAAAGGACATCTTGG - Intronic
924550530 1:245072170-245072192 TCACCCACTAAAGGACATCTTGG - Intronic
924654902 1:245965486-245965508 TCACCTACTGAAGGACATCTTGG - Intronic
924739407 1:246786022-246786044 TGACCTACAGAAGGAGGTCTTGG - Intergenic
924840187 1:247701272-247701294 TCACCTATTGAAGGACTTCTGGG - Intergenic
1062819310 10:522319-522341 TCACCTACTGAAGGGCATCTTGG + Intronic
1062866459 10:859624-859646 TCACCTACTGAAGGACATCTTGG - Intronic
1062900687 10:1143232-1143254 TCACCCACTGAAGGACATCTTGG + Intergenic
1063458060 10:6198870-6198892 TTACCTACCAAAGGACATCTTGG + Intronic
1063633065 10:7752661-7752683 TCACCTACTGAAGGATATCTTGG - Exonic
1063677716 10:8156226-8156248 TCACCTACTGCAGGACATCTTGG + Intergenic
1064369663 10:14740202-14740224 TCACCTATTGAAGGACATCTTGG - Intronic
1065224220 10:23526586-23526608 TCACCTACTGAAGGATCTCTTGG + Intergenic
1065318947 10:24491151-24491173 TCATCTACACATGGAAGTCTGGG - Intronic
1065360608 10:24885742-24885764 TCACCTACTGAAGGACCTCTGGG - Intronic
1065526371 10:26625382-26625404 TCACCTAGCGAAGGACATCTTGG + Intergenic
1065903905 10:30231427-30231449 TCAGTTACACAAGGAAGTCTGGG + Intergenic
1066510093 10:36085601-36085623 TCACCTATTGAAGGACATCTTGG + Intergenic
1067459663 10:46448360-46448382 TCACCTACTCGAGGACATCTTGG - Intergenic
1067627525 10:47936253-47936275 TCACCTACTCGAGGACATCTTGG + Intergenic
1067857545 10:49808394-49808416 TCACCTACTGAAGAACATCTTGG - Intergenic
1067880558 10:50040695-50040717 TCATCTACTGAAGGACATCTTGG + Intergenic
1067891322 10:50138674-50138696 TCATCTACTGAAGGACATCTTGG - Intergenic
1068494511 10:57769806-57769828 TCATCTACTGAAGGACATCTTGG - Intergenic
1068578576 10:58712452-58712474 TCACCTACTGAAGGACATCTTGG - Intronic
1069240070 10:66128389-66128411 TCACCTACCAAAGGAGATCTTGG - Intronic
1069322834 10:67194311-67194333 TTACCTACTAAAGGACCTCTTGG - Intronic
1069401155 10:68048272-68048294 TCACCTACTGAAGGACGTCTTGG - Intronic
1069586804 10:69611770-69611792 TCACCTACTGAAGTACATCTTGG - Intergenic
1070412824 10:76159629-76159651 CCACCTACTGAAGGACCTCTTGG - Intronic
1070839796 10:79476354-79476376 TTACCTATTCAAGGACATCTTGG - Intergenic
1071023656 10:81086767-81086789 TCACCTACTGAAGGACATCTTGG + Intergenic
1071076560 10:81760818-81760840 TCACCTAATGAAGGACATCTTGG + Intergenic
1071237894 10:83670565-83670587 TCACCTAATGAAGGACATCTTGG + Intergenic
1071850204 10:89561088-89561110 TCACCTATTGAAGGACATCTTGG - Intergenic
1072178920 10:92960107-92960129 TCACCTACTGAAGGACATCTTGG - Intronic
1072292816 10:93980377-93980399 TCACCTATTGAAGGATGTCTTGG + Intergenic
1072571372 10:96660753-96660775 TCACCTACTGAAGGACATCTTGG - Intronic
1073847422 10:107573654-107573676 TCACCTACTAAAGGACATCTTGG - Intergenic
1074622134 10:115136837-115136859 TCACCTACTGAAGGACATCTTGG + Intronic
1074668930 10:115765067-115765089 TCACCTACTGAAGGGAGTCTTGG + Intronic
1075501357 10:122978010-122978032 TCACCTACTGAAGGACATCTTGG - Intronic
1075770691 10:124932203-124932225 TCACCCACTGAAGGACATCTTGG + Intergenic
1076079990 10:127570620-127570642 TCACCTTCACAATGACCCCTGGG + Intergenic
1076444601 10:130504110-130504132 TCACCTGCTGAAGGACATCTGGG + Intergenic
1076487118 10:130830136-130830158 TCACCTACTGAAGGACAGCTTGG - Intergenic
1076575766 10:131465817-131465839 TCACCTCCTGAAGGACATCTTGG + Intergenic
1077449025 11:2623665-2623687 TCACCTATGGAAGGACATCTCGG + Intronic
1078050147 11:7958112-7958134 TCACCTATTGAAGGACATCTTGG + Intergenic
1078890885 11:15557752-15557774 TCACCTACTGAAGGACAGCTTGG - Intergenic
1079327130 11:19503690-19503712 TCACCTACTGAAGGATGTCTTGG + Intronic
1079634569 11:22719854-22719876 TCATCTACTAAAGGACATCTTGG + Intronic
1079688238 11:23389125-23389147 TCACCTACTTAAGAACATCTTGG + Intergenic
1080179894 11:29412913-29412935 TCACCTACTGAAAGACATCTTGG + Intergenic
1080305979 11:30836809-30836831 TCACCTACTGAAGGACATCTTGG - Intronic
1080499749 11:32859183-32859205 TCACCTACTTAAGAACATCTTGG - Intergenic
1081357369 11:42127874-42127896 TCACCTACAGAAGGATATCTTGG - Intergenic
1082721893 11:56688269-56688291 TAACCTACAAAAGGACATCTTGG - Intergenic
1083057626 11:59838127-59838149 TCACATACACTGGGAAGTCTAGG - Intronic
1083073667 11:60014495-60014517 TCACCTATTGAAGGACATCTTGG + Intergenic
1083916710 11:65750157-65750179 TCACCTACTGAAGGACATCTTGG + Intergenic
1084283328 11:68114302-68114324 TCATCTACTGAAGGACATCTGGG - Intronic
1084500519 11:69532350-69532372 TCACCTACTGAAGGACTTGTGGG - Intergenic
1084507567 11:69578132-69578154 TCACCTACTGAAAGACATCTGGG + Intergenic
1084662701 11:70556283-70556305 TCACCTACTGAAGGACATCCAGG + Intronic
1085093742 11:73741601-73741623 TCACCTACTGAAGGACATTTTGG - Intronic
1085342003 11:75738127-75738149 TCACCTATTGAAGGACATCTTGG - Intergenic
1085838482 11:79982287-79982309 TCATCTACTGAAGGACATCTTGG - Intergenic
1086037126 11:82430116-82430138 TAACCTACTGAAGGACATCTTGG - Intergenic
1086608228 11:88723272-88723294 TCACCCACTGAAGGACATCTTGG + Intronic
1087461260 11:98451524-98451546 TCACCTATGGAAGGACATCTTGG + Intergenic
1087803718 11:102533102-102533124 TCACCTACTGAACGACATCTTGG - Intergenic
1088163131 11:106898442-106898464 TCACCTATAGAAGGACATCTTGG - Intronic
1089227057 11:116933506-116933528 TCACCTACTGAAGGACATTTTGG + Intronic
1089591441 11:119543843-119543865 TCACCTACTGAAGGACATTTTGG + Intergenic
1090108786 11:123882342-123882364 TCACCTACTGAAGGATATCTTGG - Intergenic
1090168238 11:124574999-124575021 TCACCTACTGAAGGACATCTTGG - Intergenic
1090524609 11:127519166-127519188 TCACCTACTCAAGGCCACCTTGG + Intergenic
1090739866 11:129649307-129649329 TTACCTACTGAAGGACATCTTGG - Intergenic
1090847297 11:130541080-130541102 TCAACTACTGAAGGACATCTTGG + Intergenic
1090893267 11:130946668-130946690 TCACCTACTGAAGGACAACTCGG + Intergenic
1091462829 12:658352-658374 TCACCTACCGAAGGACATCTTGG - Intronic
1091547812 12:1515209-1515231 TCACCCACTGAAGGACATCTGGG + Intergenic
1092361729 12:7842275-7842297 TCACCTACTGAAGGACATCTTGG + Intronic
1092577245 12:9799983-9800005 TCACCTACTGAAAGACATCTTGG + Intergenic
1092699413 12:11210798-11210820 TCACCTACTAAAGAACATCTTGG - Intergenic
1093020183 12:14196237-14196259 TCACCTACCGAAGGACGTCTTGG - Intergenic
1093296339 12:17396644-17396666 TCACCTACTAAAGGACATCTTGG - Intergenic
1094087975 12:26614564-26614586 TCACCTATTGAAGGACATCTTGG - Intronic
1094215299 12:27934558-27934580 TCACCTAATGAAGGACATCTTGG - Intergenic
1094314577 12:29124283-29124305 TCACCTACTGAAGGACATGTTGG + Intergenic
1094679454 12:32655148-32655170 TCACCTACTGAAGGACGTCTTGG - Intergenic
1094780037 12:33780463-33780485 TCACCTACTGAAGGACATCTGGG + Intergenic
1095166036 12:38973161-38973183 TCACCTATTGAAGGACATCTTGG + Intergenic
1095376580 12:41536181-41536203 TCACCTACTGAAAGACATCTTGG - Intronic
1095862427 12:46932848-46932870 TCACTTACTGAAGGACATCTTGG - Intergenic
1096205838 12:49721103-49721125 TCATCTACTGAAGGACATCTTGG + Intronic
1096902126 12:54895043-54895065 TCACCTATTGAAGGACATCTCGG - Intergenic
1096998170 12:55853429-55853451 TCACTTACTGAAGGACATCTTGG - Intergenic
1097126121 12:56776882-56776904 TCACCTATTGAAGGACATCTTGG + Intronic
1097256462 12:57679434-57679456 TCATCTACAGAAAGACATCTTGG - Intergenic
1097291677 12:57921930-57921952 TCACCTACTGAAGGGCATCTTGG - Intergenic
1097571752 12:61341915-61341937 TCACCTACTCCAGGATATCTTGG + Intergenic
1098285246 12:68900622-68900644 TCACCTACTGAAGGACCTCTTGG - Intronic
1099629242 12:85119403-85119425 TCACCTACTGAATGACATCTTGG + Intronic
1099821214 12:87712921-87712943 TCACCTATTGAAGGACATCTTGG - Intergenic
1099870603 12:88344429-88344451 TCACTTACTGAAGGACATCTTGG + Intergenic
1100003431 12:89865286-89865308 TCACCTACTGAAGGACATCTTGG - Intergenic
1100181741 12:92093438-92093460 TCACCTACTGAAGGACATATTGG + Intronic
1100322647 12:93510335-93510357 TCACCTGCTGAAGGACATCTTGG + Exonic
1101043970 12:100785640-100785662 TCCTCTACAGAAGGACATCTTGG + Intronic
1101053760 12:100891215-100891237 TTACCTACTGAAGGACATCTTGG + Intronic
1101246962 12:102892534-102892556 TCACCTATTGAAGGACATCTTGG - Intronic
1101431009 12:104627234-104627256 TCACCTACTGCAGGACATCTTGG + Intronic
1101497035 12:105264475-105264497 TCACCTACTGAAAGACATCTTGG - Intronic
1101635445 12:106536751-106536773 TCACCTATTGAAGGACATCTTGG - Intronic
1102415280 12:112756645-112756667 TCACCTATTCAAAGACATCTAGG + Intronic
1102811730 12:115830137-115830159 TCACCTACTGAAGGACATCATGG + Intergenic
1104482151 12:129117004-129117026 TCACCTACTAAAGGATATCTTGG - Intronic
1104616482 12:130274176-130274198 TCACCTACTGAAGGATGTCTTGG + Intergenic
1105295304 13:19083964-19083986 TCACCTACTGAAGGGCATCTTGG - Intergenic
1105518030 13:21108064-21108086 TCACCTACAGAAGGACATCTTGG + Intergenic
1105546955 13:21357707-21357729 TCACCTACTGAAGGATATCTTGG - Intergenic
1105685809 13:22780526-22780548 TCACCTACAGAAGGACACCTTGG - Intergenic
1105711519 13:23013932-23013954 TCACCAATAGAAGGACATCTTGG + Intergenic
1105766399 13:23564292-23564314 TCACCTATTGAAGGACATCTTGG - Intergenic
1105965673 13:25382327-25382349 TCACCTACTGAAGAACATCTTGG + Intronic
1106109763 13:26766537-26766559 TCACCTACTGAAGGACATCTTGG + Intergenic
1106110199 13:26770531-26770553 TCACCTACTGAAGGACATCTTGG - Intergenic
1106150271 13:27093769-27093791 TCACTTACTGAAGGACGTCTTGG - Intronic
1106300081 13:28456216-28456238 TCACCTACCAAAGGACATCTTGG - Intronic
1107257225 13:38442397-38442419 TCACCTACTGAAGGACATCTTGG + Intergenic
1107265970 13:38554868-38554890 TCACCTACTGAAAGACGTTTTGG + Intergenic
1107663945 13:42669792-42669814 TCACCTACTGAAGGACATCTTGG - Intergenic
1108243174 13:48488149-48488171 TCACCTCCTGAAGGACATCTTGG - Intergenic
1108392962 13:49965843-49965865 TCACTTACTGAAGGACATCTTGG - Intergenic
1108995181 13:56722496-56722518 TCACCTACTGAAGGACATCTTGG - Intergenic
1108998918 13:56769950-56769972 TCACCTACTAAAGGACATCTTGG - Intergenic
1109596506 13:64562435-64562457 TAACCTACTGAAGGACATCTTGG + Intergenic
1110935690 13:81285241-81285263 TCACCTATAGAAGGATATCTTGG + Intergenic
1112070811 13:95847698-95847720 TCACCTACTAAAAGACATCTTGG + Intronic
1112313668 13:98342336-98342358 TCACCTACTGAAGGACATTTTGG - Intronic
1112627112 13:101117760-101117782 TCTCCTACTGAAGGACATCTTGG + Intronic
1112670291 13:101627844-101627866 TCACCTACTGAAGGACGTCTTGG + Intronic
1113500316 13:110768479-110768501 TCACCTACTGAAGGACATCTTGG - Intergenic
1114826205 14:26083373-26083395 TCACCTATTAAAGAACGTCTTGG - Intergenic
1115004139 14:28460643-28460665 TCACCTACTGAAGGAAATCTTGG - Intergenic
1115064928 14:29246711-29246733 TCACCTAGTAAAGGACATCTTGG + Intergenic
1115093820 14:29610756-29610778 TCACCTACTGAAAGACATCTTGG - Intronic
1116020181 14:39451335-39451357 TCACCTACTGAAGAACTTCTTGG - Intergenic
1116370879 14:44130094-44130116 GCACCTACTGAAGGACGTCTTGG - Intergenic
1116504106 14:45656936-45656958 TCATCTACAGAAGGACATCTTGG + Intergenic
1116723406 14:48529588-48529610 TCACCTACCAAAGAACATCTTGG + Intergenic
1117160231 14:52982255-52982277 TCACCTACTGAAGGACATCTTGG + Intergenic
1117259207 14:54013139-54013161 TCACCTACTGAAGGACATCTTGG + Intergenic
1117505116 14:56394384-56394406 TCACCTACTTAAGGACGTTTTGG - Intergenic
1117607615 14:57446211-57446233 TTACCTACTGAAGAACGTCTTGG + Intergenic
1117769224 14:59115894-59115916 TCACTTACAGAAGAACATCTTGG - Intergenic
1118050787 14:62025028-62025050 TCACCTACTGAAGGACATCTTGG + Intronic
1118095091 14:62527488-62527510 TCACCTACTGAAAGACTTCTTGG - Intergenic
1118131697 14:62972602-62972624 TCACCTACTGAAGAACATCTTGG - Intronic
1118236917 14:64014263-64014285 TCACCCACTGAAGGACATCTGGG + Intronic
1118608445 14:67520578-67520600 TCACCTACTGAAGGAAATCTTGG + Intronic
1118608459 14:67520711-67520733 TCACCTACTGAAGGAAATCTTGG + Intronic
1118800813 14:69187900-69187922 TCACCTACTGAAAGACATCTTGG + Intergenic
1119039071 14:71255886-71255908 TCACCTATTCAAGGACATTTTGG - Intergenic
1119278076 14:73378497-73378519 TCACCTGCTGAAGGACATCTTGG - Intronic
1119537513 14:75414662-75414684 TCACCTACTAAAGGATATCTTGG - Intergenic
1119737200 14:76990638-76990660 TCACCTACTGAAGGATATCTTGG + Intergenic
1120737855 14:88075451-88075473 TCACCTAGTGAAGGACATCTTGG - Intergenic
1121225247 14:92317033-92317055 ACACCTAAACAAGGAAGTCTGGG - Intergenic
1121396980 14:93634097-93634119 ACACATACACAAGGACCTCATGG + Intronic
1122332575 14:100933140-100933162 TCACCTACTGAAGGATATCTTGG + Intergenic
1122732713 14:103813148-103813170 TCATCTACTGAAGGACATCTTGG - Intronic
1122739629 14:103864474-103864496 TGACCTACTGAAGGACATCTTGG + Intergenic
1122851414 14:104534113-104534135 TCACCTATTGAAGGACATCTTGG + Intronic
1202894490 14_KI270722v1_random:191306-191328 TCACTTACTGAAGGACATCTTGG + Intergenic
1123795243 15:23764277-23764299 TCACCTACTGAAGGACATCTTGG + Intergenic
1124071589 15:26398437-26398459 TCACCTATTGAAGGACATCTTGG + Intergenic
1124429677 15:29595728-29595750 TCACCTACTGAAGGACATTTTGG + Intergenic
1124507458 15:30290615-30290637 TCATCCACACAAGGACACCTGGG - Intergenic
1124635931 15:31365320-31365342 TCACCCTCACAGGGATGTCTTGG - Intronic
1124681064 15:31731317-31731339 TCACCTACTGAAGGACATCTTGG - Intronic
1124736097 15:32248044-32248066 TCATCCACACAAGGACACCTGGG + Intergenic
1125119879 15:36143094-36143116 TCACCTACTGAAGGACATCTTGG - Intergenic
1125868991 15:43080599-43080621 TCACCTACTGAAGGACATCTTGG + Intronic
1126157095 15:45575766-45575788 TCACCTACTGAAAGACATCTTGG - Intergenic
1126419101 15:48452849-48452871 TCACCTATCGAAGGACATCTTGG - Intronic
1127209064 15:56752805-56752827 TCACCTACTGAAGGACATCTTGG + Intronic
1127240392 15:57107161-57107183 TCACCTACTGAAGGACATCTTGG - Intronic
1127675678 15:61236139-61236161 TCACCTACTGAAGGACATCTTGG + Intergenic
1128596153 15:68951928-68951950 TCACCTACTGAAGGACATCTTGG + Intronic
1128624815 15:69189438-69189460 TCACCTACTGAAGGACATATTGG + Intronic
1128760156 15:70211109-70211131 CCACCTACTGAAGGACATCTTGG - Intergenic
1128814806 15:70600499-70600521 TCACCTACTGAAGGACATCTTGG - Intergenic
1128934562 15:71734260-71734282 CCACCTACTGAAGGACTTCTTGG - Intronic
1129065241 15:72897651-72897673 GCACCTACTGAAGGACATCTTGG + Intergenic
1129094118 15:73184553-73184575 TCACCTACTGAAGGACATCTTGG - Intronic
1129289468 15:74552828-74552850 TCACCTCCTGAAGGACGTCTTGG + Intronic
1129309674 15:74697412-74697434 TCACCTACTGAAAGACATCTTGG + Intergenic
1129634718 15:77303154-77303176 TTACCTACTGAAGGACATCTTGG + Intronic
1129647588 15:77451156-77451178 TCACCTACTGAAGGACATCTTGG + Intronic
1130010047 15:80144857-80144879 TCACCTATTGAAGGACATCTTGG - Intergenic
1130041566 15:80409472-80409494 TCACCTACTGAAGGACATCTGGG + Intronic
1130950774 15:88585614-88585636 TCACCTACTGAAGGACATCTTGG - Intergenic
1130961488 15:88662046-88662068 TCACCCATTGAAGGACGTCTGGG - Intergenic
1131235189 15:90690670-90690692 TCACCTACTGAAGGACATCTTGG + Intergenic
1132257527 15:100389557-100389579 TCACCTACTGAAGGATATCTTGG - Intergenic
1132296675 15:100740268-100740290 TCACCCACTGAAGGACATCTGGG + Intergenic
1132327506 15:100984074-100984096 TCACTTACACAAGAATATCTAGG + Intronic
1132377071 15:101335697-101335719 TCCCCTACTCATGGACGTTTAGG + Intronic
1132401842 15:101514254-101514276 TCACCTACCGAGGGACGTCTTGG + Intronic
1133163278 16:3927026-3927048 TCACCTACTGAAGAACATCTTGG - Intergenic
1134425495 16:14139730-14139752 TCACCTACTGATGGACATCTGGG - Intronic
1134645601 16:15862911-15862933 TCACCTACTGAGGGACATCTTGG - Intergenic
1134772252 16:16819539-16819561 TCACCTACTGAAGGGTGTCTTGG + Intergenic
1135021946 16:18970213-18970235 TCACCTACTAAAGGACATGTTGG - Intergenic
1135528934 16:23235906-23235928 TCACCTACTGAAGGGCATCTTGG - Intergenic
1135939069 16:26805267-26805289 TCACCTACTGAAGGATGTGTTGG - Intergenic
1136107985 16:28044503-28044525 TCACCTACTCAAGAGCATCTTGG - Intronic
1137426008 16:48381502-48381524 TCACCTACTGAAGGATGTCTTGG - Intronic
1137966399 16:52938045-52938067 TCACCGACTGAAGGACATCTTGG - Intergenic
1138306712 16:55983721-55983743 TCACCTACAGAAAGACATCTTGG + Intergenic
1138356079 16:56381448-56381470 TCACCTACTTAAGGACATCTTGG - Intronic
1139138925 16:64237526-64237548 CAACCTAAACAAGGAAGTCTGGG + Intergenic
1139184021 16:64782585-64782607 TCACCTACTGAAGGACATCTTGG + Intergenic
1139313100 16:66043582-66043604 TCACCTACTGAAGGACATCTTGG - Intergenic
1139727972 16:68917298-68917320 TCACCTACTGAAGGACATCTTGG + Intronic
1140110842 16:72003596-72003618 TCACCTACACAACAACTTCTGGG - Intergenic
1140697521 16:77549655-77549677 TCATCTACTGAAGGACCTCTTGG + Intergenic
1141458895 16:84164660-84164682 TCACCTACTAAAAGACATCTTGG + Intronic
1141825273 16:86474572-86474594 TCACCTACTAAAGGACATCTTGG - Intergenic
1141966410 16:87447600-87447622 TCTCCTACTCATGGACATCTGGG + Intronic
1142929218 17:3268241-3268263 TCACCTACAGATGGACATTTGGG + Intergenic
1142962622 17:3560381-3560403 TCACCTACTGAAGGACATTTTGG - Intergenic
1144012468 17:11162689-11162711 TCACCTACTGAAGGACATCTTGG - Intergenic
1144166894 17:12621086-12621108 TCATCTACTGAAGGACATCTTGG + Intergenic
1144359029 17:14473822-14473844 TCACCTACTGAAGGACATCTTGG + Intergenic
1144752608 17:17659969-17659991 CCACCTACTGAAGGACATCTTGG - Intergenic
1147608329 17:41786499-41786521 TCACCTGCCCAGGGACGGCTGGG + Intronic
1147897993 17:43764181-43764203 TCATCTACTGAAGGACATCTTGG + Intergenic
1148129064 17:45252085-45252107 TCACCTACGGAAGGACATCCGGG - Intergenic
1148556797 17:48583342-48583364 TCACCCACACAAGGAGGTTCAGG + Intronic
1149132517 17:53321941-53321963 TCACCTACTGAAAGACATCTTGG - Intergenic
1149146693 17:53502282-53502304 TCACCCACTGAAGGACATCTTGG + Intergenic
1149443505 17:56695219-56695241 TCACCTCCTGAAGGACATCTTGG + Intergenic
1149460272 17:56823806-56823828 TCACCTCCAGAAGAACATCTTGG - Intronic
1149502914 17:57168448-57168470 TCACCTACTGAAGGACATCTTGG + Intergenic
1149725821 17:58893203-58893225 TCACCTACTAAAGGACATCTTGG - Intronic
1149881449 17:60296257-60296279 TCACATACACAGGGACTTCAAGG - Intronic
1150154941 17:62845136-62845158 TCACCTACTGAAGGACATCTGGG - Intergenic
1150580006 17:66464270-66464292 TCACCTACTGAAGGGCGTCTGGG + Intronic
1150973054 17:70052363-70052385 TCACCTACTGAAGGACATCTTGG + Intergenic
1151505720 17:74525713-74525735 TCATCTACACAAGGAGGCCCTGG - Intronic
1151891565 17:76953854-76953876 TCACCTACTGAAGGACATCTTGG + Intergenic
1153144475 18:2014631-2014653 TCATCTACTGAAGGACATCTTGG + Intergenic
1153185317 18:2479762-2479784 TCACCTACTGAAGGACATCTTGG - Intergenic
1153532398 18:6060901-6060923 TCACCTATTGAAGGACATCTTGG + Intronic
1153693996 18:7621861-7621883 TCACCTACTGAAGGATATCTTGG + Intronic
1154167254 18:12025267-12025289 TCACCTACTAAAGGACATCTTGG + Intronic
1154337836 18:13480159-13480181 TCTCCTACTGAAGGACATCTGGG - Intronic
1154944612 18:21149053-21149075 TCACCTACTGAAGGATCTCTTGG + Intergenic
1154986276 18:21554376-21554398 TCACCTACTGCAGGATGTCTTGG - Intronic
1155417004 18:25609647-25609669 TCACCTACTGAAGGATATCTTGG - Intergenic
1155692261 18:28639548-28639570 TCATCCACTCATGGACGTCTAGG + Intergenic
1155752882 18:29451627-29451649 CCACCTACTAAAGGACATCTTGG - Intergenic
1155880649 18:31144361-31144383 TTACCTACTGAAGGACATCTTGG - Intronic
1155910254 18:31497919-31497941 TCCCCAACCCAAGGACGTCACGG + Intergenic
1156248597 18:35328680-35328702 TCACCTACCAAAGGACGTTTTGG + Intergenic
1157341907 18:46786250-46786272 TCACCTACTGAAAGACATCTTGG + Intergenic
1157363514 18:47041596-47041618 TCACCTACTGAACGACATCTTGG + Intronic
1158400882 18:57120677-57120699 TCATCTACCAAAGGACATCTTGG - Intergenic
1158633612 18:59137597-59137619 TCACCCACTAAAGGACATCTTGG + Intergenic
1159272682 18:66172695-66172717 TCACCTTCTGAAGGACATCTAGG - Intergenic
1159487244 18:69078321-69078343 TCACCTACTGAATGACATCTTGG - Intergenic
1159530007 18:69643651-69643673 TCACCTACTGAAGGACATCTGGG + Intronic
1159758306 18:72393100-72393122 TCACCTAATGAAGGACATCTTGG - Intergenic
1159948995 18:74465789-74465811 TCACCTACTGAAGGACTCCTTGG + Intergenic
1162234855 19:9300538-9300560 TCACCTACTGAAGGACTTCTTGG - Intronic
1163117827 19:15199046-15199068 TCACCCACACCAGGACCTGTGGG + Intronic
1164493787 19:28738814-28738836 TCACCTATTGAAGGACGTCTGGG - Intergenic
1164665520 19:30031192-30031214 TCACCTACTGAAGGACATCTTGG + Intergenic
1164740640 19:30573128-30573150 TCACTTACACAGGGATCTCTGGG - Intronic
1164815655 19:31200317-31200339 TCACCTACTCAAGAACATATTGG - Intergenic
1164968998 19:32514466-32514488 TGACCTACTAAAGGACATCTTGG - Intergenic
1165031869 19:33003575-33003597 TCATCTGCTCATGGACGTCTGGG - Intronic
1165358999 19:35322275-35322297 TCACCTAGTGAAGGACGTATTGG + Intronic
1165663776 19:37607703-37607725 TCACCTACTAAAAGACATCTTGG + Intronic
1167541234 19:50088723-50088745 TCATCTACTGAAGGACATCTTGG - Intergenic
1168518085 19:57025301-57025323 TCACCGACTGAAGGACATCTTGG - Intergenic
925074591 2:1004932-1004954 TCACCTTCTGAAGGACATCTTGG - Intronic
925244638 2:2370144-2370166 TCACCTACTGAAGGACGTCTTGG + Intergenic
925253178 2:2459719-2459741 TCACCTGCTGAAGGACATCTTGG - Intergenic
925543964 2:4998842-4998864 TCACCTATTGAAGGACATCTTGG - Intergenic
925774068 2:7316014-7316036 TCTCCTACTGAAGGACATCTTGG - Intergenic
925786089 2:7432205-7432227 ACACCTACACAAGGCAGTGTGGG - Intergenic
926040874 2:9672102-9672124 TCACCTATTAAAGGACATCTGGG + Intergenic
926212559 2:10881790-10881812 TCACCTGCTGAAGGACATCTGGG + Intergenic
926497554 2:13610419-13610441 TCACCTACTGAAGGACATCTTGG - Intergenic
926592544 2:14755230-14755252 TCACCTACTGTAGGACATCTTGG - Intergenic
926630561 2:15132173-15132195 TCACCTACTGAAGGACACCTTGG - Intergenic
926780821 2:16470315-16470337 TCACCTACTGAAGGACATCTTGG - Intergenic
926835871 2:17019267-17019289 TCACCTACTGAAGGAAATCTTGG + Intergenic
927205962 2:20610620-20610642 TCACCTACCAAAGGACATCTTGG + Intronic
927750722 2:25667866-25667888 TCACCTACTGAAGGACATCTTGG - Intronic
927764901 2:25797981-25798003 TCACCTACTGAAGGACATCTTGG - Intronic
927931157 2:27045380-27045402 TCATCTACTGAAGGACATCTTGG + Intronic
928308282 2:30189524-30189546 TCACCTCCTGAAGGACATCTTGG - Intergenic
928452664 2:31390405-31390427 TCACCTACTGAAGGACATCTTGG + Intronic
928936217 2:36681081-36681103 TTACCTACTGAAGGACATCTTGG + Intergenic
928948094 2:36790169-36790191 TCTCCTACTCAAAGACGTTTTGG + Intronic
929236810 2:39614019-39614041 TCACCTATTGAAGGACATCTTGG + Intergenic
929409538 2:41682175-41682197 TCACCTACTAAAGGACATCTTGG + Intergenic
930341007 2:50114604-50114626 TCACCTACTGAAGGACATCTTGG - Intronic
931024241 2:58090805-58090827 TCACCTACTCAAAGACATCTTGG - Intronic
931405664 2:61975257-61975279 TCACCTACTGAAGGACATTTTGG + Intronic
931838068 2:66120507-66120529 TCACTTACTGAAGGACATCTTGG + Intergenic
932058749 2:68473396-68473418 TCACCTACTAAAGGTCATCTTGG + Intronic
932515644 2:72345425-72345447 TCACCTACTAAAGGACATCTTGG - Intronic
932980227 2:76654545-76654567 TCAACTACTGAAGGACATCTTGG + Intergenic
933081106 2:77987850-77987872 TCACTTACTGAAGGACGTCTTGG - Intergenic
933530162 2:83498860-83498882 TCACCTACTGGAGGACATCTAGG - Intergenic
933630915 2:84656198-84656220 TCACCTACTGAAGGACATCTTGG + Intronic
933679381 2:85086052-85086074 TCACCTACTGAAGGGCATCTTGG + Intergenic
933872908 2:86587357-86587379 TCACCTACTGAAAGACATCTTGG - Intronic
934100728 2:88650692-88650714 TCACCTACTAAAGTACATCTTGG + Intergenic
935049941 2:99516856-99516878 TCACCCACTGAAGGACATCTAGG + Intergenic
935129234 2:100248843-100248865 TCACCTGCTGAAGGACATCTTGG + Intergenic
935231876 2:101105962-101105984 TCACCTATTGAAGGACATCTTGG - Intronic
935271509 2:101438475-101438497 TCACCTAATGAAGGACATCTAGG + Intronic
935806322 2:106751720-106751742 TTACCTACTGAAGGACATCTTGG - Intergenic
936069764 2:109358292-109358314 TCACCTACTAAACGACATCTTGG + Intronic
936620599 2:114093197-114093219 CCACCTACTGAAGGACATCTTGG + Intergenic
936727727 2:115341837-115341859 TCACCTATTGAAGGACATCTTGG + Intronic
936774706 2:115958733-115958755 TCATCTACTTAAGGACATCTTGG + Intergenic
937978732 2:127598007-127598029 TCACCTGTAGAAGGACATCTGGG + Intronic
938060198 2:128248361-128248383 TCACCTACTGAAAGACATCTTGG - Intronic
938401749 2:130998712-130998734 TCACCTACTGTAGGACATCTTGG + Intronic
938705597 2:133922084-133922106 TCACCTGCCGAAGGACATCTTGG + Intergenic
938719229 2:134051097-134051119 TCACCTACAGAAGGACAACCTGG - Intergenic
938791803 2:134682867-134682889 TCATCTACTGAAGGACATCTTGG - Intronic
939007714 2:136808481-136808503 TCACCTATTGAAGGACATCTTGG + Intronic
939029899 2:137059768-137059790 TCACCTACTGAAGTACATCTTGG + Intronic
939638808 2:144614540-144614562 TCACCTACTTAATGACATCTTGG + Intergenic
939664418 2:144933114-144933136 TCACCTACTGAAGGACATCTTGG + Intergenic
940166153 2:150774951-150774973 TCACCTACTGAAGGACATCTTGG - Intergenic
940410099 2:153351852-153351874 TCACCTACTGAAGGATATCTTGG + Intergenic
940539733 2:154996828-154996850 TTACCTACTGAAGGACATCTTGG - Intergenic
940853313 2:158708594-158708616 TCACCTATTGAAGGACATCTAGG + Intergenic
940996388 2:160154673-160154695 TCACCTACTAAAGGACATCTTGG - Intronic
941265851 2:163360921-163360943 TCACCTACTGAAGAACATCTTGG + Intergenic
941485666 2:166077812-166077834 TCACCTACTGAAGGACATCTTGG - Intronic
941603653 2:167568124-167568146 TCACCTACTGAAGGACATCTTGG + Intergenic
941633537 2:167910339-167910361 TCACCTACTGATGGACATCTTGG + Intergenic
941689599 2:168485738-168485760 TCACCTATTAAAGGACGTCTTGG + Intronic
941717380 2:168778375-168778397 TCACCTACCGAAGGACAACTTGG - Intergenic
941867844 2:170353153-170353175 TCACCTACTGAAGGACATCTTGG - Intronic
941956184 2:171207144-171207166 TCATCTACTGAAGGACATCTTGG - Intronic
942011904 2:171771967-171771989 TCATCTACTAAAGGACATCTTGG - Intergenic
942111999 2:172691810-172691832 TCATCTACTGAAGGACATCTTGG + Intergenic
942245273 2:174002401-174002423 TCACCTACTGAAGGACATCTTGG - Intergenic
942364527 2:175209614-175209636 TCACCTACTGAAGGACTTCTTGG + Intergenic
942366903 2:175237876-175237898 ACACCTACAGAAGGATGTCTTGG + Intergenic
943234268 2:185297920-185297942 TCACCTACTGAAGGATATCTTGG + Intergenic
943432540 2:187822757-187822779 TCACCTACTGGAGGACATCTTGG - Intergenic
943464626 2:188213712-188213734 TCACCTACTGAAGGACATTTTGG + Intergenic
943840147 2:192570181-192570203 TCACTTACTGAGGGACGTCTTGG + Intergenic
943926434 2:193788486-193788508 TCACCTAGTAAAGGACATCTTGG - Intergenic
943928993 2:193825410-193825432 TCACCTACTGAAAGACATCTTGG - Intergenic
943944275 2:194038973-194038995 TCACCTACTGAAGGACATCTTGG - Intergenic
944028885 2:195208071-195208093 CCACCTACTGAAGGACATCTTGG + Intergenic
944080653 2:195784493-195784515 TCACCTACTAAAGGACATCTTGG + Intronic
944379767 2:199094644-199094666 TTACCTACTGAAGGACATCTAGG - Intergenic
945021405 2:205575767-205575789 TCACTTACTAAAGGACATCTTGG + Intronic
945186875 2:207148301-207148323 TCACTTACTCATGGAAGTCTGGG + Intronic
945731666 2:213544914-213544936 TCACCCACTCAAGGACAGCTTGG + Intronic
945787811 2:214265023-214265045 TCACCTATTGAAGGACATCTTGG + Intronic
945798539 2:214395102-214395124 TCACTTACTGAAGGACATCTTGG + Intronic
946661431 2:222004395-222004417 TCACCTATGGAAGGACATCTTGG + Intergenic
946711667 2:222512870-222512892 TTACCTACTGAAGGACATCTTGG + Intronic
946862888 2:224016723-224016745 TCACCTACTGAAGAACATCTGGG - Intronic
946917440 2:224539549-224539571 TCATCTGCAGAAGAACGTCTTGG - Intronic
948078111 2:235182541-235182563 TCACCTACTGAAGGACATCCTGG + Intergenic
948300465 2:236902827-236902849 TCATCTACTGAAGGACGTCTTGG - Intergenic
948344668 2:237285656-237285678 TCACCTACTGAAGGACATCTTGG + Intergenic
949038567 2:241833526-241833548 TCACTTACGAAAGGACATCTTGG - Intergenic
1168899167 20:1345853-1345875 TCACCTATTAAAGGACATCTTGG + Intronic
1168976560 20:1970399-1970421 TCACCTCCTGAAGGACATCTTGG - Intergenic
1169032470 20:2420883-2420905 TCACCTACTGAAGGACTTCTTGG + Intronic
1169221937 20:3828772-3828794 TCACCTACTGAAGGACATCTTGG + Exonic
1169276191 20:4235231-4235253 TCAGCTACAGAAGGGAGTCTGGG - Intronic
1169547815 20:6668707-6668729 TCATCTACTGAAGGACATCTTGG - Intergenic
1170008173 20:11691741-11691763 TCACCTACTGAAGGACATTTTGG - Intergenic
1170161566 20:13318583-13318605 TCACCTACTGAAGGACATCTTGG - Intergenic
1170205853 20:13797341-13797363 TCACCTACTGAAGGACATCTTGG - Intronic
1170378026 20:15723684-15723706 TCCCCTACTAAAGGACATCTTGG + Intronic
1170411231 20:16094500-16094522 TCACATACTGAAGGACATCTTGG + Intergenic
1170611581 20:17918040-17918062 TCACCTACTGAAGAACATCTTGG - Intergenic
1170651765 20:18249332-18249354 TCACCTACTGAAGGACGTCTTGG + Intergenic
1170712455 20:18804193-18804215 TCACCTACTGAAGAACATCTTGG - Intergenic
1170782961 20:19442099-19442121 TCACCTACTGAAGAACATCTTGG + Intronic
1170976519 20:21169963-21169985 TCACCTACTGAAGAACATCTTGG + Intronic
1171136991 20:22703673-22703695 TCACCTACTGAAGGACATCTTGG + Intergenic
1171151747 20:22833692-22833714 TCATCTACTGAAGGACATCTGGG - Intergenic
1171178054 20:23069511-23069533 TCACCTAGCAAAGGACATCTTGG - Intergenic
1172580082 20:36040384-36040406 TCACCTACTGAAAGACATCTTGG - Intergenic
1172616442 20:36289039-36289061 TAACCTACTGAAGGACATCTTGG + Intergenic
1172636786 20:36415480-36415502 CCACCTACACAAGGAGGTCAGGG - Intronic
1173532095 20:43777749-43777771 TCACCTACTGAAGGACATCTTGG - Intergenic
1174024526 20:47562147-47562169 TCACCTATTGAAGGACATCTTGG + Intronic
1174834713 20:53845841-53845863 TCATCTACCAAAGGACATCTTGG + Intergenic
1175326757 20:58134871-58134893 TCACCAACCCAAGGACATCGCGG - Intergenic
1175454271 20:59098740-59098762 TCACCTACTGAAGGACATCTCGG + Intergenic
1175519752 20:59592891-59592913 TCACCTGCTGAAGGACATCTTGG + Intronic
1175620278 20:60439102-60439124 TCACCCACTCAAGGACATTTTGG + Intergenic
1177001088 21:15614063-15614085 TCACCTGCTAAAGGACATCTGGG - Intergenic
1177274507 21:18891415-18891437 TCACCTATTGAAGGACATCTTGG - Intergenic
1177349620 21:19920150-19920172 TCACTTACAAAAGGACATCTTGG - Intergenic
1177476457 21:21630339-21630361 TCACCTACTGAAGGACATCTTGG - Intergenic
1177598114 21:23273254-23273276 TCACCTACACACAGCTGTCTAGG + Intergenic
1177799936 21:25818832-25818854 TCACCTAAACTAAGAAGTCTTGG - Intergenic
1177957651 21:27619942-27619964 TCACCTTCACAACTACTTCTTGG + Intergenic
1178031414 21:28530603-28530625 TCTCCTACTGAAGGACATCTCGG + Intergenic
1178381100 21:32109565-32109587 TCACTTACTGAAGGACATCTTGG - Intergenic
1178636939 21:34312450-34312472 TCACCTACTGAAGGACATTTTGG - Intergenic
1178770925 21:35503365-35503387 TCACCTACTGAAAGACATCTTGG + Intronic
1179018206 21:37613513-37613535 TCACCTACTGAAGGACACCTTGG - Exonic
1179148365 21:38788957-38788979 TCACATACACAAGGGCTTTTGGG + Intergenic
1179806054 21:43837936-43837958 TCACATACAGAAGGACATCTTGG - Intergenic
1180047145 21:45312865-45312887 TCACCTACTGAAGGACATCTTGG - Intergenic
1180644382 22:17326485-17326507 TCCCCTACTGAAGGACATCTTGG - Intergenic
1180659908 22:17457748-17457770 TCACCAACTGAAGGACATCTGGG - Intronic
1181638483 22:24185082-24185104 TCACCTCCACAGGGACGTGCAGG + Exonic
1181921672 22:26325622-26325644 TCACCTACAGTAAGAAGTCTTGG + Intronic
1182708304 22:32303699-32303721 CCACCTACAGATGGACATCTTGG + Intergenic
1183761104 22:39818959-39818981 TCACCTACTGAAGGATATCTTGG - Intronic
1184362794 22:44028545-44028567 TCACCTGCTGAAGGACATCTTGG + Intronic
1184396002 22:44241183-44241205 CCACCTACTGAAGGACATCTTGG + Intergenic
1185265062 22:49897220-49897242 TCACCTACTGAAGGGCATCTTGG + Intergenic
1185293838 22:50043084-50043106 CCATCTACCGAAGGACGTCTCGG - Intronic
1185293842 22:50043128-50043150 CCATCTACTGAAGGACGTCTCGG - Intronic
1185293855 22:50043260-50043282 CCATCTACCGAAGGACGTCTCGG - Intronic
1185293871 22:50043392-50043414 CCATCTACCGAAGGACGTCTCGG - Intronic
1185293876 22:50043436-50043458 CCATCTACCGAAGGACGTCTCGG - Intronic
949234886 3:1796234-1796256 TCACCTACCAAAGGACATCTTGG - Intergenic
949286939 3:2417728-2417750 TCATCTACTGAAGGACATCTTGG - Intronic
949978762 3:9485693-9485715 TCACCTACTGAAGGACATCTTGG - Intergenic
950149687 3:10677158-10677180 TCACCTACTGGAGGACATCTTGG - Intronic
950257351 3:11516665-11516687 TCACCTACTGAAGGACATCTCGG - Intronic
950321822 3:12062831-12062853 TCACCTACTGAAGGACATCTTGG - Intronic
950635264 3:14309812-14309834 TCACCTGCTGAAGGACATCTTGG - Intergenic
950657400 3:14445062-14445084 TCCCCTGAACAAGGACGGCTTGG - Intronic
950823236 3:15785801-15785823 TCACCTACTTAAGGGCATCTTGG - Intronic
950980454 3:17298623-17298645 TCACCTACTGAAGGACATCTTGG - Intronic
951215530 3:20021423-20021445 TTACCTACTGAAGGATGTCTTGG - Intergenic
951436607 3:22672524-22672546 TCACCTACTGAAGGATATCTTGG - Intergenic
951969055 3:28422613-28422635 TCACCTACTGAAGGATATCTTGG + Intronic
951973999 3:28482394-28482416 TCACCTATGAAAGGACATCTTGG + Intronic
952131337 3:30367007-30367029 TCACCTACTGAAGGACATCTTGG + Intergenic
952426151 3:33176240-33176262 TCACCTACTGAAGTACATCTTGG + Intronic
952475334 3:33703837-33703859 TCACCTACTGAGGGACATCTTGG - Intronic
952478925 3:33739886-33739908 TCATCTACTGAAGGACATCTTGG + Intergenic
953173480 3:40528387-40528409 TCACCTACTGAAGGACATCTCGG + Intronic
953192699 3:40702556-40702578 TCACCTAGTGAAGGACATCTTGG + Intergenic
953502265 3:43448588-43448610 TCATCTACCGAAGGACATCTTGG + Intronic
953577581 3:44125623-44125645 TCACCTACTGAAGGACACCTTGG - Intergenic
953781964 3:45879254-45879276 TCACCTGCTGAAGGACATCTTGG - Intronic
953801793 3:46030453-46030475 TCACCTATTGAAGGACATCTTGG + Intergenic
953934718 3:47030850-47030872 TCACTTACTGAAGGACATCTTGG - Intronic
954880036 3:53828993-53829015 TCACCTACTGAAGGATATCTTGG - Intronic
955169875 3:56552749-56552771 TCACCTACTGAAGGACATCCTGG + Intergenic
955262982 3:57413034-57413056 TAACCTACTGAAGGACATCTTGG - Intronic
955861708 3:63337608-63337630 TCAACTATTCAAGGACATCTTGG - Intronic
956771373 3:72528841-72528863 TTACCTACTGAAGGATGTCTTGG - Intergenic
956817244 3:72919229-72919251 TCACCTACTGAAGGATATCTTGG - Intronic
957756581 3:84496228-84496250 TCACATATTGAAGGACGTCTTGG - Intergenic
957906829 3:86568450-86568472 TCACCTACTGAAGGATATCTTGG - Intergenic
958017171 3:87952062-87952084 TGACCTACTCAAGGAAATCTTGG + Intergenic
958624634 3:96608217-96608239 TCACCTACTGAAGGACATGTTGG + Intergenic
958933545 3:100233160-100233182 TCACCTATTGAAGGACATCTTGG - Intergenic
959772526 3:110116782-110116804 TCAACTACTGAAGGACATCTTGG + Intergenic
959969459 3:112392861-112392883 TCACCTATTGAAGGACATCTTGG + Intergenic
960717321 3:120589561-120589583 TCACCTACTGAAGGACATCTTGG - Intergenic
960834140 3:121887166-121887188 TCAACTACTGAAGGACATCTTGG + Intergenic
960904584 3:122587190-122587212 TCACCTACTGCAGGACATCTTGG + Intronic
961217799 3:125174576-125174598 TCACCTACTGAAGGACATCTTGG - Intronic
961353519 3:126319185-126319207 TCACCTACTGAAGGACATGTTGG + Intergenic
961691411 3:128672620-128672642 TCACCTACTGAAAGACATCTTGG + Intronic
961764951 3:129202683-129202705 TCACCTGCTGAAGGACATCTTGG + Intergenic
962166190 3:133050900-133050922 TCACCTACTGAAGGACATCTTGG + Intronic
962194104 3:133343469-133343491 TCACCTGCTGAAGGACATCTTGG - Intronic
962194258 3:133346031-133346053 TCACCTATTCAAAGACATCTTGG + Intronic
962568216 3:136685563-136685585 TCACCTACCGAAGGACGTCTTGG - Intronic
962705956 3:138044813-138044835 TCACCTACTGAAGGACATCTTGG + Intergenic
962822474 3:139064748-139064770 TCACCTACTGAAGGACATCTTGG + Intronic
962992937 3:140596071-140596093 TCACCTACCGAAGGAAATCTTGG + Intergenic
963026150 3:140921255-140921277 TCACATACAGAAGGGCATCTTGG + Intergenic
963389081 3:144634497-144634519 CCACCTACTGAAGGACATCTGGG - Intergenic
963768028 3:149358200-149358222 TCATCTACTGAAGGACATCTTGG + Intergenic
963845806 3:150156782-150156804 TCACGTACTGAAGGACATCTTGG - Intergenic
964818560 3:160743966-160743988 TCACCTACTGAAGGACATCTTGG + Intergenic
964917681 3:161855853-161855875 TCACCTACTGAAGGACATCTTGG - Intergenic
964941375 3:162160077-162160099 TCATCTACTAAAGGACATCTTGG + Intergenic
965114629 3:164472325-164472347 TCACCTACTGAAGGACATCTTGG + Intergenic
965848856 3:172997027-172997049 TCACCTACTGAAGAACATCTTGG + Intronic
965978626 3:174658022-174658044 TCACCTACTGAAGGATATCTTGG + Intronic
966194041 3:177296402-177296424 TCACCTACTGAAAGACATCTTGG + Intergenic
966305669 3:178531282-178531304 TCAGCTACTGAAGGACATCTTGG + Intronic
967308218 3:188080228-188080250 TCTCCTATAGAAGGACATCTTGG - Intergenic
967495291 3:190136766-190136788 TCACCTACTGAAGAACATCTTGG - Intergenic
967764816 3:193267605-193267627 TCACCCACTGAAGGACGTCTTGG + Intronic
968063091 3:195741031-195741053 TCACCTGCTGAAGGACATCTTGG + Intronic
968108635 3:196022979-196023001 TCACCTACTGAAGGACATGTTGG - Intergenic
968527707 4:1072014-1072036 TCACCTACTGAAGGGCATCTTGG - Intronic
969958733 4:10920232-10920254 TCACCTACTGAAGGACATCTTGG - Intergenic
970048048 4:11878054-11878076 TCACCTACTTAAGAACATCTTGG + Intergenic
970119420 4:12736040-12736062 TCACCTACTGAAGGACATTTTGG + Intergenic
970255187 4:14160733-14160755 TCACCTACTGAAGGACATCTTGG + Intergenic
971293169 4:25363408-25363430 TCACCTACTGAAGGACATCTTGG + Intronic
971639734 4:29117112-29117134 TCACCTACTGAAGGACATTTTGG + Intergenic
971807169 4:31373838-31373860 TCACCTACTGAAAGACATCTTGG + Intergenic
971815793 4:31487049-31487071 TCACCTATTGAAGGACATCTTGG - Intergenic
972068056 4:34977273-34977295 TCACCCATTCAAGGACATCTTGG + Intergenic
972074631 4:35070639-35070661 TCACCTACTGAAGGACATCTTGG - Intergenic
972182470 4:36485781-36485803 TCACCTGCTGAAGGACATCTGGG - Intergenic
972322408 4:37984157-37984179 TCACCCACAGAAGGACATCTTGG + Intronic
972556539 4:40187423-40187445 TAACCAACACAAGGAAGTCAGGG - Intergenic
972663310 4:41139517-41139539 TCACCTATTGAAGGACATCTTGG - Intronic
972807213 4:42541620-42541642 TCACCTGCTGAAGGACATCTTGG - Intronic
972864248 4:43210866-43210888 TCACCTACTGAAGGACATATTGG - Intergenic
973289128 4:48452943-48452965 TCACCTACAGAAGGACATCTTGG - Intergenic
973881001 4:55270843-55270865 TCATCTACTGAAGGACATCTTGG - Intergenic
974445906 4:61980862-61980884 TCACCTACTGAAGGACATCTTGG + Intronic
974475088 4:62368458-62368480 TCACCTACTAAAGGACATATTGG - Intergenic
974623250 4:64387304-64387326 TCACCTACTGAAAGACATCTTGG + Intronic
974688873 4:65269591-65269613 TTACCTACCAAAGGACATCTTGG - Intergenic
975776236 4:77790304-77790326 TCACCTACTGAAGGACATCTGGG + Intronic
976172606 4:82319512-82319534 TCACTTACTGAAGGACATCTTGG - Intergenic
977428325 4:96898747-96898769 TCACCTACTGAAGGACATGTTGG - Intergenic
977429846 4:96917757-96917779 TCACCTACTGAAAGACGTCTTGG - Intergenic
977895881 4:102364589-102364611 TCACCTACTGAAGGAGATCTTGG - Intronic
977933523 4:102775103-102775125 TCACCTACTGAAGGAAATCTTGG - Intergenic
978047370 4:104147195-104147217 TCACCTACTGAAGGACTTCTTGG + Intergenic
978353781 4:107848313-107848335 TCACCTATTGAAGGACCTCTAGG + Intronic
978410718 4:108422604-108422626 TCACCTACTGAAGGAAATCTTGG - Intergenic
978526031 4:109666194-109666216 TCACCTACTGAAGGACATCTGGG + Intronic
979647026 4:123081527-123081549 TAACCTACTGAAGGACATCTTGG + Intronic
979830328 4:125292713-125292735 TCACCTACTGAAGGACATATTGG - Intergenic
979928136 4:126593756-126593778 TCATCTACTAAAGGACATCTTGG - Intergenic
979952705 4:126914258-126914280 TCACTTACAAAATGACATCTTGG - Intergenic
980441983 4:132860619-132860641 TCACCTATTGAAGGACATCTTGG + Intergenic
980502774 4:133678043-133678065 TCACCTATTGAAGGACATCTTGG + Intergenic
980800749 4:137746465-137746487 TCATCTACTGAAGGACATCTTGG + Intergenic
981118295 4:141017895-141017917 TCACCTGCTGAAGGACGTCATGG + Intronic
981572996 4:146173585-146173607 TTACCTACAGAAGGACATCTTGG - Intergenic
982058570 4:151578844-151578866 TCACCTGCTAAAGGACATCTTGG - Intronic
982588888 4:157279201-157279223 TCACCTACTGAAGGACATCTTGG - Intronic
983080917 4:163384330-163384352 TCACCTACTGAAGGATATCTAGG - Intergenic
983400976 4:167265223-167265245 TCACCTATTCAAGGACTTCTTGG + Intergenic
983795397 4:171855515-171855537 TCACCTATTGAAGGACATCTTGG + Intronic
984142154 4:176016557-176016579 TCACCTACTGAAGGACATCTTGG + Intergenic
984261657 4:177450328-177450350 TCTCCTACTGAAGGACATCTTGG + Intergenic
984297954 4:177877894-177877916 TCACCTACCAAAGGATATCTTGG + Intronic
984306908 4:178004902-178004924 TCACCTACTAAAGGGCATCTTGG + Intergenic
984703057 4:182830976-182830998 TCACCTACTGCAGGACATCTTGG - Intergenic
984788910 4:183595605-183595627 TCACCTACTAAAGGACATTTTGG - Intergenic
985015369 4:185628078-185628100 TCACCTATTGAAGGACATCTTGG + Intronic
985211260 4:187597895-187597917 TCACCTATAGAAGGACTTCTTGG - Intergenic
985299558 4:188473423-188473445 TCACGAATACAAGGACATCTGGG - Intergenic
985700202 5:1366970-1366992 TCACCTACTGAAGGGCATCTCGG - Intergenic
985849776 5:2380449-2380471 TCATCTACTGAAAGACGTCTTGG - Intergenic
986028531 5:3873387-3873409 TTACCTACTAAAGGACATCTTGG - Intergenic
986094385 5:4540624-4540646 GCACCTCTGCAAGGACGTCTGGG - Intergenic
986166330 5:5274593-5274615 TCACCTGCTTAAGGACATCTTGG + Intronic
986222292 5:5779672-5779694 TCATCTACTGAAGGACATCTTGG - Intergenic
986355932 5:6926259-6926281 TCACCTACTGAAGGACAGCTTGG + Intergenic
986669922 5:10133733-10133755 TCACCTACTGCAGGACCTCTTGG + Intergenic
987666249 5:20944891-20944913 TCACCTACTGAAGAACATCTTGG + Intergenic
988105641 5:26742988-26743010 TCACCTACTAAAGGCCATCTTGG + Intergenic
988290804 5:29283217-29283239 TCACATACTAAAGGACATCTTGG + Intergenic
988517964 5:31921007-31921029 TCACTTACTCAAGGACATCTTGG + Intronic
988635059 5:32974214-32974236 TCACCTATCCAAGGACAGCTGGG + Intergenic
989145844 5:38249424-38249446 ACACAGACACAAGGATGTCTGGG + Intergenic
989506569 5:42232455-42232477 TCACCCACTGAAGGCCGTCTTGG + Intergenic
989822945 5:45817336-45817358 TCACCTATTAAAGGACATCTTGG - Intergenic
989980057 5:50632853-50632875 TCACCTATTGAAGGACATCTTGG - Intergenic
990059154 5:51625782-51625804 TCACCTACTAAAGGACATCTTGG + Intergenic
990603986 5:57389012-57389034 TCACCTATAGAAGGACATCTTGG + Intergenic
991008155 5:61852573-61852595 TCACCTACTGAAAGACATCTTGG - Intergenic
991528103 5:67585704-67585726 TCACCTATTAAAGGACTTCTTGG - Intergenic
991539498 5:67711084-67711106 TCACCAACTGAAGGACATCTTGG - Intergenic
991629388 5:68639873-68639895 TCACCTACTGAAGGACATCTTGG + Intergenic
992857860 5:80881729-80881751 TCACCTACTGAAGGACATCTTGG + Intergenic
993049042 5:82904095-82904117 TCACCTACTGAAGGACTTCTTGG + Intergenic
993312243 5:86348887-86348909 TCACCTACTGAAGGACATCCTGG - Intergenic
993603664 5:89959965-89959987 TCACTTACTGAAGGACATCTTGG + Intergenic
994439691 5:99786765-99786787 TCACCTACTAAAGAACATCTTGG + Intergenic
994717659 5:103341897-103341919 TTACCTACTGAAGGACATCTTGG + Intergenic
994922431 5:106065169-106065191 TCACCTACTGAAGAACATCTTGG + Intergenic
994964831 5:106655478-106655500 TCACCTACTGAAGGACATCTTGG - Intergenic
995145053 5:108778192-108778214 TCACCTACTGAAAGACATCTTGG + Intronic
995708969 5:115015481-115015503 TCATCTCCCAAAGGACGTCTTGG - Intergenic
996909889 5:128643798-128643820 TCACCTACTGAAGGGCATCTCGG - Intronic
997054915 5:130430645-130430667 TTACCTACTGAAGGACATCTTGG - Intergenic
997117611 5:131142239-131142261 TCACCTCCTGAAGGACATCTTGG - Intergenic
997677821 5:135726710-135726732 TCACCCACTGAAGGACATCTGGG + Intergenic
998178946 5:139922697-139922719 TCATCTACTGAAGGACATCTTGG - Intronic
998189350 5:140009702-140009724 TTACCTACTGAAGGACATCTTGG - Intronic
998311075 5:141132886-141132908 TCACCTACTAAACGACATCTTGG - Intronic
999411484 5:151353959-151353981 TCACCTACTGAAAGACATCTTGG + Intergenic
999427815 5:151502836-151502858 TCACCTTCTCAAGGACATCTTGG - Intergenic
999536222 5:152520182-152520204 TCACCTACTGACGGGCGTCTTGG + Intergenic
999552018 5:152699541-152699563 TCACCTATTGAAGGACATCTTGG + Intergenic
999695270 5:154183254-154183276 TCACCTACTGAAGGACATATTGG - Intronic
999713135 5:154336228-154336250 TCACCTACTGAAGGACATCTTGG + Intronic
1000280914 5:159781203-159781225 TCACCTGCTGAAGGACATCTTGG + Intergenic
1000432943 5:161172268-161172290 TCATCTACTGAAGGACATCTTGG + Intergenic
1000580420 5:163028931-163028953 TCACCTACTTAAGGACATCTTGG + Intergenic
1001457820 5:171879350-171879372 TCACCTACTGAAGGACACCTTGG + Intronic
1001946828 5:175786167-175786189 TCACCTACTGAAGGACATCTTGG + Intergenic
1002328752 5:178427515-178427537 TCACCTACTGAAAGACATCTTGG - Intronic
1002573414 5:180157260-180157282 TCACCTGCAGAAGGACATCTTGG - Intronic
1002627074 5:180537044-180537066 TCACCTACTGAAGGACATCTTGG + Intronic
1002993648 6:2261693-2261715 TCACCCACTGAAGGATGTCTTGG + Intergenic
1003237286 6:4307036-4307058 TCACCTACTGAAGGACATCTTGG + Intergenic
1003843105 6:10143093-10143115 TCACCTGCTAAAGGACATCTTGG - Intronic
1004283984 6:14303244-14303266 TCACCTAATGAAGGACATCTTGG + Intergenic
1004792716 6:19045135-19045157 TCACCTACTAAAGGACATTTTGG + Intergenic
1004794132 6:19062372-19062394 TCACCCACTGAAGGACATCTTGG + Intergenic
1004918979 6:20358370-20358392 TCACCTACTTAAGGGCATCTTGG + Intergenic
1004952045 6:20684097-20684119 TCACTTACTGAAGGACATCTTGG + Intronic
1005218419 6:23558555-23558577 TCACCTACTGAAGGACATCTTGG + Intergenic
1005724653 6:28636550-28636572 TCACCTACAGAAGGAAATCTTGG + Intergenic
1006482867 6:34312767-34312789 TCACCTACTGAAGGACATCGTGG - Intronic
1006488110 6:34361622-34361644 TCACCTACTGAAGGACGTCATGG - Intronic
1006546953 6:34788247-34788269 TCACCTGCTGAAGGACATCTGGG - Intergenic
1007457366 6:41989919-41989941 TCACCTACTGAAGGACAGCTTGG - Intronic
1008920155 6:56834943-56834965 TCACCGACTGAAGGACATCTTGG - Intronic
1009293743 6:61917191-61917213 TCACCTACTGAAGGACATCTTGG - Intronic
1009754092 6:67912493-67912515 TCACCTATTGAAGGACTTCTTGG + Intergenic
1009764393 6:68050789-68050811 TCACCTATTGAAGGACATCTTGG + Intergenic
1009786964 6:68352881-68352903 TCACCTATTGAAGGACATCTTGG + Intergenic
1009960515 6:70515351-70515373 TTACCTACTGAAGGACATCTTGG - Intronic
1010151544 6:72738648-72738670 TCACCTACTGAAGGACATCTTGG - Intronic
1010384978 6:75269538-75269560 TCACCTACTGAAGGACATCTTGG + Intronic
1010770787 6:79827523-79827545 TCACCTACTGAAGAACATCTTGG - Intergenic
1010917936 6:81643586-81643608 TCACATACTAAAGGACATCTTGG - Intronic
1011005828 6:82644513-82644535 TCACCTATTGAAGGACATCTTGG - Intergenic
1011016852 6:82766229-82766251 TCACCTACTGAAGGACATTTTGG - Intergenic
1011278047 6:85648844-85648866 TCACCTATTGAAGGACATCTTGG - Intergenic
1011359171 6:86503554-86503576 TCACCTACTCAATGATGTCCTGG + Intergenic
1011566885 6:88684480-88684502 TCACCTATTCAAGGACATCTTGG - Intronic
1011658340 6:89572168-89572190 TCACCTACTGAAGGACATCTTGG + Intronic
1011880348 6:92016244-92016266 TCACCTACAAAAGGACATCATGG + Intergenic
1011894841 6:92212714-92212736 TCACCTACTGAAGAACATCTTGG - Intergenic
1011963500 6:93121910-93121932 TTACCTACTGAAGGACATCTTGG + Intergenic
1012138897 6:95595948-95595970 TCACCTAATGAAGGACATCTTGG - Intronic
1012152946 6:95778251-95778273 TCACCTACTGAAGGACATCTTGG + Intergenic
1012763569 6:103333784-103333806 TCACCTAGTCAAAGACATCTTGG - Intergenic
1012801223 6:103831747-103831769 TTACCTACAAAAGGGCATCTTGG - Intergenic
1012926000 6:105268494-105268516 CCACCTACTGAAGGACATCTTGG - Intergenic
1013114920 6:107095638-107095660 TTACCTACTAAAGGACATCTTGG - Intronic
1013321838 6:108999880-108999902 TCACCTATTGAAGGACATCTTGG - Intronic
1013413874 6:109907105-109907127 CCACCTACCAAAGGACATCTTGG + Intergenic
1013502693 6:110768484-110768506 TCACCTACTGAAGGATATCTTGG - Intronic
1013863781 6:114668944-114668966 TCACCTACTAAAGCACATCTTGG + Intergenic
1014008505 6:116449479-116449501 TCACCTACTGATGGACATCTTGG + Intergenic
1014116305 6:117672041-117672063 TCACCTACTGAAGGACAACTTGG - Intergenic
1014203562 6:118630531-118630553 TCACCTACTGAAGGACATCTTGG - Intronic
1014322946 6:119953986-119954008 TCACCCACTAAAGGACATCTTGG + Intergenic
1014324253 6:119972078-119972100 TCACCTACTGAAGGACATCTTGG - Intergenic
1014350272 6:120333922-120333944 TCACCTATTGAAGGACATCTTGG - Intergenic
1014390430 6:120856693-120856715 TCACCTACTGAAGGACATTTTGG - Intergenic
1014394580 6:120909795-120909817 TCACCTACTAAAGGAGATCTTGG + Intergenic
1014596304 6:123344672-123344694 TCACCTATTGAAGGACATCTTGG + Intronic
1014704832 6:124732919-124732941 TCACCTACTCAAGAACATCTTGG - Intronic
1014861496 6:126473151-126473173 TCACCTACTGAAGGACATCTTGG + Intergenic
1015092251 6:129372542-129372564 TCCCCTACTGAAGGACATCTTGG + Intronic
1015105491 6:129531672-129531694 TCACCTATTGAAGGACATCTTGG - Intergenic
1016133114 6:140501783-140501805 TCACCTAGAGAAGGACATCTTGG + Intergenic
1016283984 6:142452029-142452051 TCACCTACTGAAGGATGTATTGG + Intergenic
1016396862 6:143633002-143633024 TCACCCACTGAAGGACATCTTGG + Intronic
1016446250 6:144135139-144135161 TCACCTACTGAAGGACATCTTGG - Intergenic
1017068770 6:150553299-150553321 TCACCTACTGAAGGACATTTTGG + Intergenic
1017231074 6:152074489-152074511 TCACCTACTGAAGGATGTGTTGG + Intronic
1017623190 6:156319688-156319710 TCACCTACTGAAGGACATCTTGG + Intergenic
1017652007 6:156592457-156592479 TCACCTACTGAAGGACATCTTGG - Intergenic
1017777826 6:157693278-157693300 TCACCTGCAAAAGGACATCTTGG - Intergenic
1018045369 6:159961257-159961279 TCACTTACACGAGGCGGTCTTGG + Intergenic
1018335866 6:162788408-162788430 TCACCCACTGAAGGACATCTTGG + Intronic
1018550007 6:164985063-164985085 TTACCTACTGAAGGACATCTTGG + Intergenic
1018550012 6:164985147-164985169 TTACCTACTGAAGGACATCTTGG + Intergenic
1018553289 6:165023693-165023715 TTACCTACTGAAGGACATCTTGG - Intergenic
1019208664 6:170385726-170385748 TCACCCACTGAAGGACATCTTGG - Intronic
1020498202 7:8883411-8883433 TCACCTACTGAAAGACATCTTGG - Intergenic
1021652862 7:22848382-22848404 TCACCTACTTAAGGACATCTTGG + Intergenic
1021667818 7:23004142-23004164 TCAGCTACAAAACAACGTCTAGG - Intronic
1022579702 7:31539078-31539100 TCACCTACTGAAGGACATCTTGG + Intronic
1022625064 7:32026755-32026777 TCACCTATAAAAGGACATCTTGG - Intronic
1022820669 7:33957194-33957216 TCACCTACTGAAGGGCATCTGGG - Intronic
1022870536 7:34472867-34472889 TCACCTACTAAAGGACATCTTGG + Intergenic
1022876031 7:34531322-34531344 TCACCTACTGAAGGACATCTTGG - Intergenic
1022899894 7:34796921-34796943 TTACCTACCAAAGGACATCTTGG - Intronic
1022963576 7:35453238-35453260 TCACCTATTAAAGGACATCTTGG - Intergenic
1023033976 7:36114818-36114840 TCACCTATTGAAGGACATCTTGG + Intergenic
1023036172 7:36133387-36133409 TCACCTACTGAAGGACATTTGGG - Intergenic
1023379461 7:39592076-39592098 TCACCTACTAAAGGACTTCTTGG + Intronic
1023903462 7:44503257-44503279 TCACCTACTGAAGGACATCTTGG + Intergenic
1023942413 7:44778102-44778124 TCACCTACTGAAGGGCATCTTGG - Intergenic
1024032774 7:45478486-45478508 TCACCTATTGAAGGACATCTTGG - Intergenic
1024036005 7:45508092-45508114 TCACCTACTGAAGGACATCTTGG + Intergenic
1024104605 7:46069939-46069961 TCACCTACCAAAGGACTTCTTGG - Intergenic
1024163147 7:46701118-46701140 TCACCTACTGAAGAACATCTTGG - Intronic
1024276939 7:47685218-47685240 TCACTTACTGAAGGACATCTTGG + Intergenic
1024632704 7:51262640-51262662 TCACCATCACATGGACGTCTGGG + Intronic
1024854800 7:53765579-53765601 TCACCGACTGAAGGACATCTTGG + Intergenic
1024923125 7:54582064-54582086 TCACCTACTGAAGGACATGTCGG - Intergenic
1025105001 7:56163370-56163392 TCACCTACTCCATGAAGTCTAGG + Intergenic
1026080309 7:67212393-67212415 TCACCTATTGAAGGACATCTTGG + Intronic
1026435826 7:70396769-70396791 TCACCTACTGATGGACGTCTGGG + Intronic
1026696781 7:72601609-72601631 TCACCTATTGAAGGACATCTTGG - Intronic
1026705308 7:72686308-72686330 TCACCTACTGAAGGACATCCTGG - Intronic
1027242224 7:76338786-76338808 TCACCTTCACAATGAAGCCTTGG - Intronic
1027277058 7:76568005-76568027 TCACCTACTGAAGGACATCTTGG - Intergenic
1027477976 7:78657419-78657441 TTACCTACTAAAGGACATCTTGG - Intronic
1027617119 7:80437076-80437098 TCATCTACTGAAGGACGTCTTGG + Intronic
1027619014 7:80460073-80460095 TCAGCTACAGAAGGACATCTTGG - Intronic
1027698613 7:81440953-81440975 TCACCTACCGAAGGTCATCTAGG - Intergenic
1027836565 7:83251445-83251467 TCACATACAGAAGGACATCTTGG + Intergenic
1027982798 7:85248571-85248593 TCACCTACTAAAGGACACCTTGG - Intergenic
1028194688 7:87892478-87892500 TTACCTACTAAAGGACATCTTGG + Intronic
1028770137 7:94609953-94609975 TCACCTACTGGAGGACATCTTGG - Intronic
1028926509 7:96362475-96362497 TCACCTACTGAAGGGCATCTTGG + Intergenic
1028995145 7:97091762-97091784 TCACCTACTGAAGGATATCTTGG + Intergenic
1029092148 7:98056839-98056861 TCACCTTCAGAAGGAGATCTAGG + Intergenic
1029152771 7:98492611-98492633 TAACCCACACAAGGACGCCACGG - Intergenic
1029529736 7:101117371-101117393 AAACCTACACAAGGGGGTCTGGG + Intergenic
1029780958 7:102732006-102732028 TCACTTACTGAAGGACATCTGGG + Intergenic
1029882848 7:103835046-103835068 TCACCAACTGAAGGACATCTTGG - Intronic
1030049398 7:105524294-105524316 TCAGCTACTGAAGGACATCTTGG - Intergenic
1030095872 7:105899258-105899280 TCACCTACTGAAGGATGTCTTGG + Intronic
1030416306 7:109247794-109247816 TCACCTACTGAAGGACATCTTGG + Intergenic
1030503558 7:110389936-110389958 TCTCCTACTAAAGGACTTCTGGG - Intergenic
1030538124 7:110794246-110794268 TCATCTGCTCAAGGACGTCTTGG - Intronic
1030875881 7:114812749-114812771 TCACCTACTGAAGAACATCTTGG + Intergenic
1031116185 7:117671311-117671333 TGACCTACTAAAGGACATCTTGG + Intronic
1031225291 7:119029399-119029421 TCACCTATTGAAGGACATCTTGG - Intergenic
1031428003 7:121631167-121631189 TCACCTACTGAAGGACAGCTTGG + Intergenic
1031446989 7:121867180-121867202 TCACCTACTGAAGGACATGTTGG - Intergenic
1031581873 7:123486087-123486109 TCACCTACACAATCATGTCCAGG - Intronic
1031609746 7:123811084-123811106 TCACCTACTGAAGGACATTTTGG + Intergenic
1031924277 7:127623442-127623464 TCACCTATTGAAGGACGCCTTGG + Intergenic
1032058645 7:128705134-128705156 TCACCTGCTGAAGGACATCTGGG + Intergenic
1032178506 7:129653870-129653892 TCACCTACGGAAGGACATTTTGG + Intronic
1032209365 7:129898959-129898981 TCACATACACAAAGACATGTAGG + Intronic
1032244093 7:130193179-130193201 TCACCTACTGAAGGGCATCTTGG - Intronic
1032770316 7:135046716-135046738 TTACCTACTGAAGGACATCTTGG + Intronic
1033467352 7:141607051-141607073 TCACCTACTGAAGTACATCTTGG + Intronic
1033467801 7:141612071-141612093 TCACCTACTAAAGGACATCTTGG - Intronic
1035487738 7:159240686-159240708 TCACTTACTGAAGGACATCTTGG - Intergenic
1035525881 8:312859-312881 TCATCTACTGAAGGACATCTTGG + Intergenic
1035761708 8:2073409-2073431 CCACCTGCACAAGGACGACGAGG + Exonic
1036462796 8:8968570-8968592 TCACTTACTGAAGGACATCTTGG + Intergenic
1036557013 8:9869029-9869051 TCACCTACTGAAGGACATTTTGG - Intergenic
1036931492 8:12960554-12960576 TCACCTATTGAAGGACATCTTGG - Intronic
1037073234 8:14678778-14678800 TCACCTACTGAAGAACATCTTGG - Intronic
1037854300 8:22359802-22359824 TCACCTACTGAAGCACATCTTGG - Intergenic
1038025344 8:23583661-23583683 TCACCTACTGAAGGACATCTTGG + Intergenic
1038273147 8:26093486-26093508 TTACCTACTGAAGGACATCTTGG - Intergenic
1038314871 8:26475634-26475656 TCACCTACTCAAGGACATCTTGG + Intronic
1038324043 8:26558188-26558210 TCACCTACTCATGGACATCTTGG - Intronic
1038508083 8:28103453-28103475 TCACCTATTGAAGGACATCTTGG + Intronic
1038518134 8:28204711-28204733 TCACCTACTGAAGGACATTTTGG - Intergenic
1038785884 8:30615919-30615941 TCACCTACTGAAGGACATCTTGG - Intronic
1038798019 8:30726889-30726911 TCACCTACTCAAGGTCGCCTTGG + Intronic
1040467510 8:47708917-47708939 TCACATACTGAAGGACATCTTGG + Intronic
1040592481 8:48806276-48806298 CCACCTACTGAAGGACATCTTGG + Intergenic
1041132664 8:54718603-54718625 TCACCTACTGAAGGACATCTTGG - Intergenic
1041168974 8:55121110-55121132 TCACCTATTGAAGGACATCTTGG + Intronic
1041486707 8:58385389-58385411 TCACCTTCTGAAGGACATCTTGG + Intergenic
1041559407 8:59197766-59197788 TCACCTATTTAAGGACATCTTGG - Intergenic
1041941617 8:63394305-63394327 TCACCTATTCAAGGACATCTTGG + Intergenic
1041951086 8:63503224-63503246 TCATCTACTAAAGGACATCTTGG + Intergenic
1042165869 8:65945579-65945601 TCACCTATTGAAGGACATCTTGG - Intergenic
1042292149 8:67180192-67180214 TCATCTACTGAAGGACATCTGGG - Intronic
1042293021 8:67189361-67189383 TCACCTACTGAAAGACATCTTGG - Intronic
1042319418 8:67459361-67459383 TCATCTACTAAAGGACATCTTGG - Intronic
1042905736 8:73769898-73769920 TCACTTACTGAAGGACATCTTGG + Intronic
1043266454 8:78272358-78272380 TCACCTATCAAAGGACATCTTGG - Intergenic
1043420656 8:80095118-80095140 TCACCTACTGAATGACATCTTGG - Intronic
1043562409 8:81509547-81509569 TTACCTACTGAAGGACATCTTGG - Intergenic
1043698232 8:83249560-83249582 TCACCTATTGAAGGACATCTTGG - Intergenic
1044052226 8:87520049-87520071 TTACCTACTGAAGGACATCTTGG + Intronic
1044668001 8:94650608-94650630 TCGCCTACTGAAGGACATCTTGG + Intronic
1044783322 8:95766466-95766488 TCACCTACTGAAGGACATCTTGG + Intergenic
1045053510 8:98349001-98349023 TCACCTACTGAAGGACATCATGG - Intergenic
1045130868 8:99150778-99150800 TCACCTACTGAAGGACATCTTGG + Intronic
1045139246 8:99261460-99261482 TCACCTACTAAGGGACATCTTGG + Intronic
1045251892 8:100489443-100489465 TCACCTATTGAAGGACATCTTGG - Intergenic
1045258434 8:100550063-100550085 TCACCTACTGAAGGACATCTTGG + Intronic
1045308465 8:100979871-100979893 TCACCTATCAAAGGACATCTTGG - Intergenic
1045400816 8:101815890-101815912 TTACCTACTGAAGGACATCTTGG - Intronic
1045424387 8:102049434-102049456 TCATCTACTGAAGGACATCTTGG + Intronic
1045870716 8:106923859-106923881 TCACCTACTGAAGGACATTTTGG - Intergenic
1045885616 8:107094294-107094316 TCACCTACTGAAGGACAACTTGG + Intergenic
1045989679 8:108291221-108291243 TCACCTACTGAAGGACATCTTGG + Intronic
1046426237 8:114053796-114053818 TCACCTACTGAAGGAAATCTTGG - Intergenic
1046490354 8:114944074-114944096 TCACCTGCTGAAGGACATCTTGG + Intergenic
1047190750 8:122677112-122677134 TCACCTACTGAAGGGCATCTTGG - Intergenic
1047613072 8:126539848-126539870 TGACCTACACTAGGGCTTCTTGG - Intergenic
1047672813 8:127166877-127166899 TCACCTACTGAAGGACATTTTGG + Intergenic
1048810674 8:138283205-138283227 TCACCTCCTGAAGGACGTCTTGG - Intronic
1049187854 8:141268058-141268080 TCACCTACACAAGGACGTCTTGG - Intronic
1050595824 9:7203819-7203841 TCACCTACTGAAGGGCATCTTGG + Intergenic
1050804484 9:9656357-9656379 TTACCTACTGAAGGACATCTTGG - Intronic
1050835462 9:10072925-10072947 TCACCTACTGAAGGACATCTTGG - Intronic
1050919519 9:11184276-11184298 TCAGCTACTAAAGGACATCTTGG + Intergenic
1050965646 9:11797900-11797922 TCACCTACTAAAGGACACCTTGG - Intergenic
1051115648 9:13691183-13691205 TCACATACTAAAGGACATCTTGG + Intergenic
1051347654 9:16167039-16167061 TCACCTACTGAAGGACATCTTGG - Intergenic
1051442216 9:17097601-17097623 TCACCAACTGAAGGACATCTTGG + Intergenic
1051765890 9:20523467-20523489 TCATCTACTGAAGGACATCTTGG - Intronic
1051988876 9:23126328-23126350 TCACCTTCTGAAGGACATCTTGG + Intergenic
1052810063 9:33050476-33050498 TCATCTACCAAAGGACATCTTGG - Intronic
1053041380 9:34876248-34876270 TCATCTACTGAAGGACATCTCGG - Intergenic
1053187544 9:36030794-36030816 TCACCTACTAAAGGACATCTTGG + Intergenic
1053271547 9:36752982-36753004 TCACCTACCAAAGGATATCTTGG - Intergenic
1054726531 9:68657568-68657590 TCACCTCCCGAAGGACGTCTTGG - Intergenic
1054822971 9:69542518-69542540 TCACCTATCGAAGGACATCTTGG + Intronic
1055005590 9:71502286-71502308 TCACCTACTAAAGGATATCTTGG - Intergenic
1055263410 9:74466750-74466772 TTAACTACACAAGTATGTCTTGG + Intergenic
1055264926 9:74484158-74484180 CCACCTACTGAAGGACATCTTGG - Intergenic
1055474523 9:76648414-76648436 TCACCTACTGAAGGACGTCTTGG - Intronic
1055863569 9:80785081-80785103 TCACCTACTGAAGGTCATCTTGG + Intergenic
1056205092 9:84312120-84312142 TCACCTACTGAAGGACATTTTGG + Intronic
1056212467 9:84377510-84377532 TCACCTACTGAAAGACATCTTGG + Intergenic
1056530639 9:87484138-87484160 TCATCTACTAAAGGACATCTTGG - Intergenic
1056844832 9:90028626-90028648 TCACCTACTGAAGGACATCTTGG - Intergenic
1057209911 9:93194802-93194824 TCACCTGCTGAAGGACATCTGGG - Intronic
1057264544 9:93605802-93605824 TCACCTACTGAAGGGCATCTTGG + Intronic
1057286825 9:93763456-93763478 TCACCTACTGAAGGGCATCTAGG - Intergenic
1057455800 9:95209008-95209030 TCACCTACCGAAGGTCATCTTGG - Intronic
1057710250 9:97434769-97434791 TCACTTACCAAAGGATGTCTGGG - Intronic
1057862750 9:98654844-98654866 TCACCTACTGAAGGACATCTTGG - Intronic
1057929508 9:99181400-99181422 TCACATACACAAGAACATCCAGG + Intergenic
1058997920 9:110317892-110317914 TCACCAACACAAGGAACACTTGG - Intronic
1059089718 9:111342865-111342887 TCACCTACTAAAGGTCATCTTGG - Intergenic
1059090840 9:111356260-111356282 TCACCTACTGAAGGACATCTTGG + Intergenic
1060111155 9:120907358-120907380 CCACCTACTGAAGGACATCTTGG + Intronic
1060507853 9:124211678-124211700 TCACCTATTGAAGGACATCTTGG + Intergenic
1061422456 9:130479711-130479733 TCACCTTCACAGGGACCCCTAGG - Exonic
1061794274 9:133075759-133075781 TCACCTGCTGAAGGACTTCTTGG - Intronic
1062431101 9:136527241-136527263 CCACCTTCTCAGGGACGTCTGGG - Intronic
1062493497 9:136820865-136820887 TCATCTACTGAAGGACGTCTTGG - Intronic
1186135869 X:6519941-6519963 TCACCTGCTGAAGGACATCTTGG + Intergenic
1186167258 X:6839977-6839999 TCACCTACTAAAGGATATCTCGG - Intergenic
1186767530 X:12786314-12786336 TCACCTACTGAAGGACATCTTGG + Intergenic
1187181875 X:16950275-16950297 TCACCTACTGAAGGATATCTTGG + Intronic
1187310979 X:18142278-18142300 TCACTTACTGAAGGACATCTTGG - Intergenic
1187783247 X:22853808-22853830 TCACCTACTGAAGGTCATCTTGG - Intergenic
1187800550 X:23057810-23057832 TCACATACTAAAGGATGTCTTGG - Intergenic
1187949566 X:24458410-24458432 TCACCTACTGAAGGATGTCTTGG - Intergenic
1188703968 X:33303155-33303177 TCACCTACTGAAGGACATCTTGG + Intronic
1188767827 X:34118152-34118174 TCACCTATTCAAGGATGTCATGG - Intergenic
1188839290 X:34995405-34995427 TCACCTACTGAAGAACATCTTGG + Intergenic
1188993452 X:36852646-36852668 TCACCTACTGAAGGACATCTTGG + Intergenic
1189464868 X:41270847-41270869 TCACCTACTGAAGGACATCTTGG - Intergenic
1189977013 X:46471859-46471881 TCACCTATTGAAGGACATCTTGG + Intronic
1190011069 X:46785545-46785567 TTACCTACTGAAGGACATCTTGG - Intergenic
1190239983 X:48650329-48650351 TCACCTACCAAAGGACATTTTGG + Intergenic
1190402330 X:50050094-50050116 TCATCTACTGAAGGACATCTTGG + Intronic
1190436084 X:50427096-50427118 TCACCTATTGAAGGACATCTTGG - Intronic
1190899978 X:54662262-54662284 TCACTTACTGAAGGACATCTTGG + Intergenic
1191684643 X:63877824-63877846 TCACCTATTGAAGGACCTCTTGG - Intergenic
1192102753 X:68282168-68282190 TCACCTACTGAGGGACATCTTGG - Intronic
1192801600 X:74470210-74470232 TCACCTACCGAAGGAAATCTTGG + Intronic
1193700474 X:84754503-84754525 TCACCTACTGAAGGACATTTTGG + Intergenic
1193854217 X:86578661-86578683 TCACCTATTGAAGGACATCTTGG + Intronic
1194488082 X:94511431-94511453 TCACCTACTAAAGGGCATCTTGG - Intergenic
1194669556 X:96713879-96713901 TCACCTACTGAAGGACATTTTGG + Intronic
1194693733 X:97019105-97019127 GCACCTACCAAAGGACATCTTGG + Intronic
1194864023 X:99043050-99043072 TTACCCACTGAAGGACGTCTTGG + Intergenic
1195408643 X:104544949-104544971 TTACCTACTGAAGGACATCTTGG - Intergenic
1195807101 X:108786531-108786553 TCACCTCTAGAATGACGTCTTGG + Intergenic
1195898211 X:109770564-109770586 TCACCTACTGAAGGACATCTTGG - Intergenic
1196000353 X:110777241-110777263 TCACCTACTGAAGGACATCTTGG + Intronic
1196313336 X:114195316-114195338 TCACCTACTAAAGAACATCTTGG - Intergenic
1196492946 X:116290097-116290119 TCTCCTATACAAGGACACCTAGG - Intergenic
1196507738 X:116468052-116468074 TAACCTACTCAAAGACATCTTGG + Intergenic
1196767316 X:119259141-119259163 TCACCTACTGAAGAACATCTTGG - Intergenic
1197073135 X:122324235-122324257 TTACCTACTGAAGGACATCTTGG - Intergenic
1197192045 X:123658444-123658466 TCACCTACTGAAGGACATGTTGG - Intronic
1197803253 X:130374382-130374404 TCACCCACTGAAGGACATCTTGG + Intergenic
1197875064 X:131093688-131093710 TCACCTACTGAAGGACATTTTGG + Intergenic
1198367556 X:135957194-135957216 TCACCTATTGAAGGACATCTTGG - Intergenic
1198410876 X:136366433-136366455 TCACCTACTGAAGGACATCTTGG + Intronic
1198490895 X:137140205-137140227 TCACCTACAGAAGGACATCTTGG - Intergenic
1198639695 X:138743139-138743161 TCACCTACTGAAGGACATCTTGG - Intronic
1198842627 X:140875292-140875314 TCACATACTGAAGGACATCTTGG - Intergenic
1199607765 X:149589996-149590018 TCACCTCTTCAAGGACATCTTGG + Intergenic
1199631358 X:149779371-149779393 TCACCTCTTCAAGGACATCTTGG - Intergenic
1199702536 X:150393339-150393361 TCACCTACTGAAGAACATCTGGG + Intronic
1199748257 X:150789941-150789963 TCACCTGCTGAAGGACATCTTGG - Intronic
1199923666 X:152438555-152438577 TCACCTACTGAAGGACATCTTGG - Intronic
1201470631 Y:14330784-14330806 TCACCTACTAAATGACATCTTGG + Intergenic