ID: 1049187858

View in Genome Browser
Species Human (GRCh38)
Location 8:141268090-141268112
Sequence TCCATCATCTGGATGTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049187858_1049187860 -2 Left 1049187858 8:141268090-141268112 CCGTGGAACATCCAGATGATGGA 0: 1
1: 0
2: 1
3: 47
4: 217
Right 1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049187858 Original CRISPR TCCATCATCTGGATGTTCCA CGG (reversed) Intronic
901432485 1:9225490-9225512 TCCATCGCCTGGATGTCCCCAGG + Intergenic
903323082 1:22554097-22554119 TCCATGATCTGCTTGCTCCATGG + Intergenic
906188476 1:43880064-43880086 TCCACCATGTGGATTTTCCAGGG - Intronic
906188770 1:43881928-43881950 TCCACCATGTGGATCTTCCAGGG - Intronic
906962172 1:50425452-50425474 TCCAACACCTGGAGGTTCCGAGG + Intergenic
907924304 1:58941586-58941608 TCCTTCAGCTCTATGTTCCAGGG + Intergenic
908268176 1:62398352-62398374 TCCAAAAGCTGGATGTTTCAGGG + Intergenic
908409932 1:63853460-63853482 TCCAAAATCTGAATGCTCCAAGG - Intronic
908553281 1:65231291-65231313 GCCATTATCTGTATGTTTCAGGG + Exonic
908795158 1:67823923-67823945 TCCATCATGTGGATGTACCATGG - Intronic
909304373 1:74054159-74054181 TCCATGGTCTGGATATACCAAGG - Intronic
909890532 1:81000627-81000649 TCCCTTCTCTGGATGTTCCAGGG - Intergenic
910751719 1:90638178-90638200 ACCATCCTCTGGAGGCTCCAGGG - Intergenic
910767993 1:90801719-90801741 TCCATTGTCTGGATGTACCACGG + Intergenic
912309318 1:108603673-108603695 TCCAAAATCTGTATCTTCCATGG - Intronic
912915282 1:113808619-113808641 TCCATGGTATGGATGTACCATGG - Intronic
914426478 1:147582239-147582261 TTCATCATATGAATGTACCAAGG + Intronic
915152074 1:153841658-153841680 TCCATGGTATGGATGTACCATGG + Intronic
915831103 1:159131040-159131062 TCCAGCTTCCAGATGTTCCATGG + Intronic
916860406 1:168797952-168797974 TCCATGGTCTGGATATACCACGG + Intergenic
920054867 1:203184481-203184503 TCCACTGTATGGATGTTCCAGGG - Intronic
920677532 1:208048542-208048564 ACCATGATCTCAATGTTCCAAGG - Intronic
920845588 1:209590615-209590637 TCCCTCTTCTGGAGCTTCCATGG - Intronic
921587761 1:216967596-216967618 TCCGTTGTCTGGATGTACCATGG + Intronic
921775586 1:219096448-219096470 TCCAACCTCTGCCTGTTCCAAGG - Intergenic
923600082 1:235395035-235395057 TCCATTGTCTGGATGTACCACGG + Intronic
923857551 1:237861309-237861331 TCCATTCCCTGGATGTACCACGG - Intergenic
1063353304 10:5375175-5375197 TTCATCATCTATATGCTCCATGG - Intergenic
1063729142 10:8676222-8676244 TCCATAATCTGCATGTATCAAGG - Intergenic
1063730186 10:8687555-8687577 TCCATGATCTGGAGCTACCAAGG - Intergenic
1063965798 10:11344786-11344808 GCCAGCAACCGGATGTTCCAGGG - Intergenic
1065475116 10:26127633-26127655 TTCATCATTTAGGTGTTCCAGGG - Intronic
1066091502 10:32025756-32025778 TCCATGATATGAATGTACCATGG - Intronic
1066597704 10:37069754-37069776 TCCAGCATCTGCCTATTCCATGG - Intergenic
1067715756 10:48690238-48690260 TCCATCAGGAGGATGCTCCATGG + Intronic
1072226287 10:93373042-93373064 ATCATCATCTGGATGATCCGGGG - Exonic
1072421660 10:95294903-95294925 TTCAACATCTGGGTGTTCTAGGG + Intergenic
1073564439 10:104522994-104523016 TACATCATCTTGCTCTTCCAAGG - Intergenic
1074712324 10:116187786-116187808 GCCTTCATCTAGATTTTCCATGG - Intronic
1076517825 10:131059016-131059038 TCCATGATATGGATTTACCACGG - Intergenic
1077321406 11:1944102-1944124 TCCATTGTCTGGATGTACCTCGG - Intergenic
1079977585 11:27110958-27110980 CCCATTGTCTGGATCTTCCAAGG + Intronic
1080778358 11:35407368-35407390 TCCTTCATCAGTATCTTCCACGG + Intronic
1080869393 11:36224209-36224231 TCTACCATCTGGATAGTCCAGGG + Intronic
1081482800 11:43505087-43505109 TCCATCATCAGAAAGTCCCATGG + Intergenic
1081647003 11:44797072-44797094 TCCATATTCTGGATGTTCCTAGG + Intronic
1083247377 11:61439804-61439826 TCCATTGTGTGGATGTACCATGG + Intronic
1083314421 11:61805515-61805537 TCCTCCATCTTGATGTGCCATGG + Intronic
1084637174 11:70399627-70399649 TCCATCACCTGGATAGTCTAAGG + Intronic
1084723131 11:70921961-70921983 TCCAATATCTGGATCATCCATGG - Intronic
1085948892 11:81305704-81305726 TCCATCATCTAGCTCTTACATGG + Intergenic
1086375703 11:86198616-86198638 TCCATCCTCTGAATGTACCATGG - Intergenic
1086628268 11:88986127-88986149 TCCATGAGATGGATGTACCATGG - Intronic
1086746835 11:90439461-90439483 TTAATCATCTTGATATTCCATGG + Intergenic
1086989692 11:93289320-93289342 TCCAGCCTCTAGATTTTCCAGGG + Intergenic
1087141920 11:94772581-94772603 TCCATAATATGGATGTACTATGG + Intronic
1087611697 11:100442351-100442373 TCCTTCTTCTGGTTGTTTCAGGG + Intergenic
1089256337 11:117196280-117196302 GCCAACATCTGGGGGTTCCAGGG - Exonic
1092733688 12:11558763-11558785 TCCATTATATGAATGTACCATGG + Intergenic
1094432339 12:30383258-30383280 TCCATTGTCTGGATGCACCACGG - Intergenic
1099113576 12:78594312-78594334 TCAATCATCTCCATCTTCCATGG + Intergenic
1101089338 12:101268832-101268854 TCCATTGTCTAAATGTTCCATGG + Intergenic
1101775786 12:107792139-107792161 CCTCTCTTCTGGATGTTCCAAGG + Intergenic
1102550573 12:113688760-113688782 GCCATCATCTGGCTTTTTCAGGG + Intergenic
1102727834 12:115081158-115081180 GCCTCCATCTGGATGTTCCAGGG - Intergenic
1103367854 12:120396204-120396226 TCCATTATATGGCTGTTCCACGG - Intergenic
1104597719 12:130131478-130131500 GGCATCATTTGGCTGTTCCATGG + Intergenic
1107159625 13:37211012-37211034 TCCATCATCTGGTTTGTCCAGGG + Intergenic
1107431399 13:40343748-40343770 TCCAAGGTCTGAATGTTCCAAGG + Intergenic
1107917973 13:45171961-45171983 TCCATCATCTGAATATTTCATGG + Intronic
1109636225 13:65121339-65121361 TGGATTATCTGGATGGTCCAAGG - Intergenic
1112747917 13:102548669-102548691 TCCATCATTTGGATATTTCAGGG + Intergenic
1115367282 14:32572430-32572452 TCCATTATGTGGCTGTTCCCTGG + Intronic
1116623063 14:47230735-47230757 TCAATCACCTGGATGTTGAATGG - Intronic
1117089032 14:52231277-52231299 TCAAATATCTGGATGTCCCATGG + Intergenic
1118370485 14:65133442-65133464 TCCATTATCTGAATGGTCCATGG - Intergenic
1120390569 14:83902328-83902350 TCCATTGTCTGGATATACCATGG - Intergenic
1122239600 14:100353822-100353844 TCCGTCATCTGGATGACCAAGGG + Exonic
1124718328 15:32088296-32088318 TCCATTGTGTGGATGTGCCATGG + Intronic
1125118643 15:36125689-36125711 TTCATCACCTGGATGCCCCACGG - Intergenic
1128624810 15:69189402-69189424 TCCATTGTCTGGATGTGCCACGG + Intronic
1129179386 15:73862738-73862760 TCCATCATCTGGATTATCTCAGG - Intergenic
1129309671 15:74697380-74697402 TCCATCGTCTGGATGTGCTGCGG + Intergenic
1130148135 15:81291145-81291167 TCTTTCATAAGGATGTTCCATGG - Intronic
1132176475 15:99719602-99719624 TCCATGGTGTGGATGTACCATGG + Intronic
1132435160 15:101794474-101794496 GAAATCATCTGGATGTTCCAGGG + Intergenic
1132947506 16:2539873-2539895 TCCATCATGTGGAACTGCCAAGG - Intronic
1132968234 16:2671752-2671774 TCCATCATGTGGAACTGCCAAGG + Intergenic
1133734217 16:8601830-8601852 TGCTTCATCTGGAGGCTCCAGGG + Intergenic
1134009063 16:10837815-10837837 TCCATTGTCTGGATGTACCTCGG - Intergenic
1134592544 16:15467057-15467079 TCCATTGTATGGATGTACCATGG + Intronic
1134755454 16:16663436-16663458 TCCATCTTATTGTTGTTCCAGGG + Intergenic
1134990612 16:18695734-18695756 TCCATCTTATTGTTGTTCCAGGG - Intergenic
1137549734 16:49429258-49429280 TGTATCGTCTGGATGTTTCATGG + Intergenic
1137900495 16:52262634-52262656 TCCATTATTTGGATATTTCAAGG + Intergenic
1137958577 16:52858072-52858094 TCCATCTTTTCAATGTTCCATGG + Intergenic
1140883320 16:79219164-79219186 TCCCTCATCTGAATGAGCCATGG - Intergenic
1141330346 16:83105341-83105363 ACCATCATCTGCATCTCCCATGG + Intronic
1143234241 17:5384393-5384415 TCCATCCACTGGATATTCCTGGG - Exonic
1143693803 17:8595047-8595069 TCCATTATATGCATATTCCATGG - Intronic
1147897989 17:43764139-43764161 TCCATCGTCTTGATGTATCACGG + Intergenic
1148905718 17:50910599-50910621 TTCATCATCTAGATGGTACATGG + Intergenic
1150591113 17:66563531-66563553 TCCATCATCTGGGTATACCATGG + Intronic
1152806293 17:82357968-82357990 TCCATTGTCTGGATGTACCATGG - Intergenic
1153949515 18:10046300-10046322 TCAGGCCTCTGGATGTTCCAGGG + Intergenic
1154319322 18:13332772-13332794 TTCATTATCTGGATGTACCATGG + Intronic
1155937695 18:31771283-31771305 TCCATTGTGTGGATGTACCACGG - Intergenic
1156686604 18:39655963-39655985 TTCATCATCTGCTTGTTCAATGG + Intergenic
1157250047 18:46087403-46087425 TCCTTACTCTGGCTGTTCCATGG - Exonic
1157806583 18:50662886-50662908 TCCATCTTCTGTCTCTTCCAGGG + Intronic
1158912169 18:62075548-62075570 TCCATCATATGGATATACAATGG + Intronic
1159626335 18:70699423-70699445 TCCACCATCTGGGTGATTCATGG + Intergenic
1160096795 18:75880655-75880677 TCCCTGATCTGAATTTTCCAGGG - Intergenic
1160241564 18:77128166-77128188 TCCGTCATCTGGATGAACCAAGG - Intronic
1161527370 19:4764985-4765007 TCCATCATGTGGATGAACTATGG - Intergenic
1162234859 19:9300570-9300592 TCTATTGTCTGGATGTACCACGG - Intronic
1162657517 19:12142466-12142488 AGCATCATCTGGATGTGGCAGGG + Intronic
1162896280 19:13766349-13766371 TCCTTCATCTTCAGGTTCCATGG + Intronic
1164106615 19:22112421-22112443 TCTCTCTTCTGGATGCTCCAGGG + Intergenic
1165032585 19:33008899-33008921 TCCATTGTCTGGATGTCCCATGG - Intronic
1166632675 19:44420941-44420963 CCCATCATCTACATGTGCCATGG + Intronic
926321416 2:11750811-11750833 TATATCACCTGGGTGTTCCAGGG - Intronic
926582903 2:14650700-14650722 TACATCAACTGGATATGCCATGG + Intronic
929864995 2:45710184-45710206 TACATCATCAGGTTGTTACAGGG - Intronic
930810910 2:55539480-55539502 TCCATTGTCTGGATGTGCCACGG + Intronic
932458718 2:71867465-71867487 TCCATTGTCTGGATGTACCACGG + Intergenic
932533645 2:72566803-72566825 TCCATTGTTTGGATGTACCATGG - Intronic
932557936 2:72842104-72842126 TCCAGCATCTGGCTGTGACAGGG + Intergenic
932808467 2:74804009-74804031 TCCATCTTGTGGATGTACCATGG - Intergenic
936729096 2:115358968-115358990 TCCATAATCTCCATGTGCCACGG - Intronic
937240106 2:120454731-120454753 GCCATCCTATGGATGTGCCAGGG - Intergenic
937513553 2:122627378-122627400 TCTATCCTCTTGATTTTCCAAGG - Intergenic
939796494 2:146651720-146651742 TCCATTGTCTGGATGTACCACGG - Intergenic
939828335 2:147042892-147042914 TCTATTGTCTGGATGTACCATGG - Intergenic
942009885 2:171750962-171750984 GCCATCATCTGTTTGTTTCATGG + Intergenic
943194680 2:184730733-184730755 TCCATTGTCTGGATGTGCCATGG + Intronic
945286372 2:208086741-208086763 TACATCATCTGGATGTGCTCAGG - Intergenic
947250458 2:228097435-228097457 TCAATAATCTGCATGTCCCAGGG - Intronic
948161913 2:235831668-235831690 TCCATTGCCTGGATGTACCATGG + Intronic
949038573 2:241833562-241833584 TCCATTGTCTGGATGGACCACGG - Intergenic
1168894822 20:1316868-1316890 TCCATGATGTGAATGTACCAGGG - Intronic
1169653039 20:7890904-7890926 TCCATCATATATATGTACCACGG + Intronic
1170667597 20:18400216-18400238 GCCATCATTTGCATGTCCCACGG - Intronic
1171024692 20:21619043-21619065 TCCATCATGTGGATGAACCACGG + Intergenic
1172839379 20:37892950-37892972 TCCGACATATGGATGTCCCAGGG + Intergenic
1174119982 20:48257603-48257625 TCCACATTATGGATGTTCCAGGG - Intergenic
1174309434 20:49639821-49639843 TCAATCATCTGTGTGTTACAGGG + Intronic
1175380920 20:58563405-58563427 TCCATCATATGGCTGTGGCACGG - Intergenic
1175690533 20:61062660-61062682 TCCATCCTGTGGATGTGCCACGG + Intergenic
1177539969 21:22479609-22479631 CCTATAATCTGGATGTCCCAAGG + Intergenic
1179073337 21:38094027-38094049 TGCATCATCAGAATGTACCAAGG + Intronic
1184062696 22:42093651-42093673 TCCATTGTCTGGATATACCAAGG - Intergenic
1184879279 22:47294830-47294852 TCCCTCGTCTGGATGCCCCAGGG + Intergenic
949234475 3:1791963-1791985 TCAGTCATCTGGAAGTTCCTGGG - Intergenic
949541097 3:5032695-5032717 TCCCTCAGCTGGAAGTTCCTGGG - Intergenic
950149693 3:10677190-10677212 TCCATTGTCTGGGTGTACCACGG - Intronic
950535264 3:13574755-13574777 TCCATCATCTAGATCCCCCAAGG + Intronic
951393347 3:22134353-22134375 TCAAGCATTTGGAAGTTCCATGG - Intronic
952622000 3:35356190-35356212 TCCATTGTCTAGATGTACCATGG - Intergenic
953193320 3:40710085-40710107 TCCATTTGCTTGATGTTCCATGG + Intergenic
953507252 3:43498359-43498381 TCAATCAGCTGGATTTTGCAGGG - Intronic
956815889 3:72907900-72907922 CCCATCATCTGGATGTTTTTAGG - Intronic
957392354 3:79593116-79593138 TCCATTGTCTGGATGTACCACGG + Intronic
958875912 3:99617022-99617044 ACCATCATCAGGATATTACATGG - Intergenic
960690434 3:120341679-120341701 TCCATCATGTTGATGTAACAGGG + Intronic
961407530 3:126692250-126692272 TTCTTCATCTGGCTGTTCAATGG + Intergenic
962874796 3:139527648-139527670 GCAAGCATCTGGATTTTCCATGG - Intronic
963164768 3:142190022-142190044 TCCATCATCTGTAGCTCCCATGG - Intronic
964819823 3:160756672-160756694 TCCATCTTCGGGATCTTCGACGG + Exonic
964946475 3:162231654-162231676 GGCACCTTCTGGATGTTCCAGGG + Intergenic
965447024 3:168786912-168786934 TCCATTGTTTGGATGTACCACGG - Intergenic
967457071 3:189700806-189700828 TACATCCTCTGAATATTCCAGGG + Intronic
970229546 4:13894708-13894730 TCCATTATATGGATGTACCATGG + Intergenic
972448671 4:39173492-39173514 TCCATAGTCTGGATATACCATGG + Intergenic
974521462 4:62986704-62986726 TCCATTATGTAGATGTTCCATGG + Intergenic
974655712 4:64817965-64817987 TCCATTGTCTGGATGTACCATGG + Intergenic
978137509 4:105280776-105280798 TCCATCATCTGGCTGAACCTTGG + Intergenic
981102505 4:140844988-140845010 TCCATGGTATGGATGTACCATGG + Intergenic
981456210 4:144955983-144956005 CCTCTCTTCTGGATGTTCCAGGG - Intergenic
982031500 4:151306157-151306179 TCCATCACCTGGAAATTCCCTGG - Intronic
982805963 4:159762853-159762875 TCCATTGTATGGATGTACCATGG + Intergenic
983486646 4:168339816-168339838 TCCATTGTCTGGATGTATCATGG + Intergenic
985308164 4:188566443-188566465 TCCATTGTCTGGATGTACAACGG + Intergenic
985539987 5:483351-483373 ACCATCATCTTCATGTTCCTGGG - Exonic
985793194 5:1943281-1943303 TCCGTTGTCTGGATGTGCCATGG + Intergenic
985823473 5:2176676-2176698 TACCTCATCTGCTTGTTCCAAGG - Intergenic
985990526 5:3556453-3556475 CTCATGATCTGGATGTACCATGG - Intergenic
987097610 5:14563836-14563858 CCCATCAGTTGGAAGTTCCAGGG + Intergenic
987255824 5:16149816-16149838 TCCATTGTATGGATGTACCACGG - Intronic
989242369 5:39216034-39216056 TCCAGCTTCTGGTGGTTCCAGGG - Intronic
990328340 5:54700025-54700047 TGCATCAACTGGATGGTCCAAGG - Intergenic
991149895 5:63355514-63355536 TCCATTGTCTGGATGTACCACGG + Intergenic
992393213 5:76348295-76348317 TCCACTGTCTGGATGTACCACGG + Intronic
994576942 5:101590280-101590302 TCCATAATCCGGATGTGTCAAGG - Intergenic
996754250 5:126919617-126919639 TGCATCAACTGGATGTTCTCAGG + Intronic
998120862 5:139576278-139576300 TCCATACTCTGGATGTTCTAGGG + Intronic
998181915 5:139951877-139951899 TGCATGACCTGGATCTTCCAGGG - Intronic
999149040 5:149414685-149414707 GCCATCAGCTGAATGTTCCCCGG - Intergenic
1001630834 5:173174171-173174193 TCCATCATCTTGGTGGTCCATGG + Intergenic
1002620978 5:180488050-180488072 TCCAGCAGCTGGATTTGCCAGGG - Intergenic
1002830706 6:817849-817871 TCCATGGTGTGGATGTGCCAGGG + Intergenic
1005196807 6:23296754-23296776 TACATCATCTGGATTTTTCATGG + Intergenic
1005856954 6:29870007-29870029 TCCATTCTCTACATGTTCCAGGG - Intergenic
1005862777 6:29914145-29914167 TCCATCCTGTGCAAGTTCCAGGG - Intergenic
1007550338 6:42724664-42724686 TTCATCACATGGATGTACCACGG + Intergenic
1008281164 6:49598330-49598352 TCTATCATTTTGATGTGCCAGGG - Intergenic
1010996707 6:82541655-82541677 TCCATCGTGTAGATGTACCATGG - Intergenic
1013342133 6:109225253-109225275 TCCCTCATATGAATGTTTCAGGG + Intergenic
1013461460 6:110378650-110378672 TCAAAAATCTGCATGTTCCACGG - Intergenic
1015474885 6:133649321-133649343 TCCTTCTTATGGATGGTCCAGGG - Intergenic
1016931217 6:149412259-149412281 TCCTTCATCTGTATGTTTAAAGG + Intergenic
1016942682 6:149496443-149496465 TCCAGCATGTGGATGTTGTATGG - Intergenic
1017559545 6:155612320-155612342 CCTCTCATCTGGATGCTCCAGGG + Intergenic
1018196800 6:161362365-161362387 CCCATCATCTGGGTCTTCCCAGG + Intronic
1019914555 7:4124364-4124386 TCCAGCATCTGGTGGTTCCGTGG + Intronic
1021647995 7:22805277-22805299 CCTCTCTTCTGGATGTTCCAGGG - Intergenic
1022266851 7:28765013-28765035 TCCATATTCTAGATGTTTCATGG - Intronic
1023215014 7:37852694-37852716 TTCATTATCTGGATATACCAGGG + Intronic
1024519103 7:50287108-50287130 TCCATTGTCTGGATGTACCACGG + Intergenic
1028707427 7:93866427-93866449 TCCAATCTCTGGATGTACCACGG + Intronic
1028770142 7:94609988-94610010 TCCATTTTCTGGATGTACCACGG - Intronic
1031469295 7:122149993-122150015 TCCATTATCTCCATGTTCCTGGG - Intergenic
1031505570 7:122577520-122577542 TCCATTGTATGGATGTGCCACGG + Intronic
1034479584 7:151309101-151309123 TCCCTCATCTGGGTCATCCAGGG + Intergenic
1036565707 8:9936206-9936228 TCCATCGTGTGGATGTGCCATGG + Intergenic
1037554168 8:20005910-20005932 TTCATCATATGGATGTGCCATGG - Intergenic
1037604164 8:20423309-20423331 TCCATCTTCTGGAGGCTCCTAGG + Intergenic
1038785890 8:30615955-30615977 TCCATCGTCTGGATATACCACGG - Intronic
1039781624 8:40792442-40792464 TCCATTGTATGGATGTGCCATGG - Intronic
1043562415 8:81509579-81509601 TCCATTGTCTGCATGTACCACGG - Intergenic
1044672821 8:94700490-94700512 TGCATCCTCTGGAGGCTCCAGGG - Intronic
1045011958 8:97966192-97966214 TCCATGATCTTGAGCTTCCATGG + Intronic
1045156543 8:99480769-99480791 TTCATCATCTGGATGTGTCCTGG + Intronic
1046501124 8:115078274-115078296 TCCATTATGTGGATGTGCCATGG + Intergenic
1048657166 8:136553424-136553446 GGAATCATCTGGAAGTTCCATGG - Intergenic
1049187858 8:141268090-141268112 TCCATCATCTGGATGTTCCACGG - Intronic
1049401532 8:142429786-142429808 TCCAACATCAGGAAGTCCCAGGG + Intergenic
1050200298 9:3138214-3138236 GCCTGCATCTGGATGTGCCAGGG - Intergenic
1050974210 9:11915949-11915971 TCTATCAAGTGGTTGTTCCACGG + Intergenic
1055723702 9:79204437-79204459 TCCATTGTCTGGATGCTCCAAGG + Intergenic
1055782007 9:79830525-79830547 TCCAACATTTGGATGTTTCTAGG + Intergenic
1056241404 9:84650735-84650757 TCCATTGTATGGATGTACCATGG + Intergenic
1056510010 9:87295628-87295650 TCAATCATCTGGAGGTCCCTGGG - Intergenic
1056850022 9:90074915-90074937 TTCATCATCTGAATGTTCTGTGG - Intergenic
1057011146 9:91602520-91602542 TCCATTGTCTGGATGTACCATGG + Intronic
1057115120 9:92513570-92513592 TCCATCATGTGGATGGGGCAGGG - Intronic
1057728485 9:97587114-97587136 TCCATGGTGTGGATGTACCAGGG + Intronic
1058502452 9:105634641-105634663 TTCACAATCTGGATTTTCCAAGG - Intronic
1061530364 9:131207145-131207167 TACATCATCTGGATTTTTCTTGG - Intronic
1061985567 9:134128384-134128406 TCCAGAATCCGGATGTCCCATGG + Intergenic
1062192014 9:135252987-135253009 GCCCTCATCTGGATTATCCAGGG + Intergenic
1186130413 X:6459672-6459694 TCCATTCTCTGGATGTACCACGG - Intergenic
1186524013 X:10231214-10231236 TCCATTGTCTGGATATGCCATGG + Intronic
1186897396 X:14017656-14017678 CCCACCTTCTGGATGTTCCTTGG + Intronic
1188261420 X:28029300-28029322 TCCATTGTATGGATGTACCATGG + Intergenic
1189674514 X:43447483-43447505 TCCATTATATGGATATACCATGG - Intergenic
1189858027 X:45243163-45243185 TCCATTATATGGATATACCACGG + Intergenic
1191156580 X:57280854-57280876 TCCATTACATGGATGTGCCATGG - Intergenic
1192288597 X:69766087-69766109 TCCATGTTATGGATGTACCACGG + Intronic
1192588000 X:72335518-72335540 TCCATTGTCTGGATGTACAACGG + Intronic
1193536295 X:82719534-82719556 TCCATTGTCTGGATGTACCACGG + Intergenic
1193727247 X:85057072-85057094 TCCTTCATATGGATGTGCCACGG + Intronic
1194131405 X:90086532-90086554 CCTCTCTTCTGGATGTTCCAGGG + Intergenic
1194272140 X:91828827-91828849 TCCATCAACTTATTGTTCCAAGG - Intronic
1196064109 X:111443793-111443815 TGCATGCTCTGGATTTTCCATGG - Intergenic
1200589388 Y:5050268-5050290 TCCATCAACTTATTGTTCCAAGG - Intronic