ID: 1049187860

View in Genome Browser
Species Human (GRCh38)
Location 8:141268111-141268133
Sequence GAATGTCATTCACCGCTAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049187858_1049187860 -2 Left 1049187858 8:141268090-141268112 CCGTGGAACATCCAGATGATGGA 0: 1
1: 0
2: 1
3: 47
4: 217
Right 1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG No data
1049187855_1049187860 21 Left 1049187855 8:141268067-141268089 CCTTGTGTAGGTGACTGAATAAA 0: 1
1: 0
2: 5
3: 92
4: 731
Right 1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG No data
1049187854_1049187860 30 Left 1049187854 8:141268058-141268080 CCAAGACGTCCTTGTGTAGGTGA 0: 1
1: 0
2: 14
3: 267
4: 717
Right 1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049187860 Original CRISPR GAATGTCATTCACCGCTAAA CGG Intronic
No off target data available for this crispr