ID: 1049188074

View in Genome Browser
Species Human (GRCh38)
Location 8:141269863-141269885
Sequence ACGGTGTCCGCTCATTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049188074_1049188079 -2 Left 1049188074 8:141269863-141269885 CCCCAGGAATGAGCGGACACCGT 0: 1
1: 0
2: 0
3: 8
4: 43
Right 1049188079 8:141269884-141269906 GTATGGCCACAGTGTGTCTATGG No data
1049188074_1049188082 19 Left 1049188074 8:141269863-141269885 CCCCAGGAATGAGCGGACACCGT 0: 1
1: 0
2: 0
3: 8
4: 43
Right 1049188082 8:141269905-141269927 GGCTGGCATCCCCACAGCAGAGG No data
1049188074_1049188080 2 Left 1049188074 8:141269863-141269885 CCCCAGGAATGAGCGGACACCGT 0: 1
1: 0
2: 0
3: 8
4: 43
Right 1049188080 8:141269888-141269910 GGCCACAGTGTGTCTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049188074 Original CRISPR ACGGTGTCCGCTCATTCCTG GGG (reversed) Intronic
900595766 1:3479511-3479533 ACCGTGCCCGGTCACTCCTGGGG - Exonic
902621309 1:17652567-17652589 CCGGTGTCCTCACCTTCCTGGGG - Intronic
903298854 1:22363710-22363732 ACCCTGTCCGCTCTTTCCTGTGG - Intergenic
912238419 1:107878681-107878703 AGGGTGTCCCATCATTACTGAGG + Intronic
1077072189 11:680309-680331 ACCCTGTCAGCTCCTTCCTGAGG - Intronic
1084546588 11:69817970-69817992 ACGGTGTCCGCCCGGGCCTGGGG - Intronic
1097521168 12:60672662-60672684 ACGGTGGCCACTCCTTCCTTAGG + Intergenic
1104126199 12:125848467-125848489 ACAGGGCCAGCTCATTCCTGTGG + Intergenic
1104661511 12:130614272-130614294 ATGGTTTTCGCTGATTCCTGTGG - Intronic
1106193752 13:27476139-27476161 CCAGTGTCCTCTCATTCCTCTGG + Intergenic
1110288233 13:73774502-73774524 ACTGTGTCCACTAATTTCTGTGG - Intronic
1132415539 15:101616120-101616142 ACTGTGTCCATTCATTCCTGCGG - Intergenic
1136567024 16:31076685-31076707 ACGGTGTCCACTGACTCCTGGGG + Exonic
1143635654 17:8162670-8162692 ACTGGGTCCGCTCCTTCCCGCGG + Intronic
1146214261 17:30966222-30966244 GCTGTCTTCGCTCATTCCTGGGG - Intergenic
1147323649 17:39660205-39660227 ACGGTGTCCCCATATTCCTATGG - Exonic
1152466696 17:80470704-80470726 ACGGCCTCGGTTCATTCCTGGGG + Exonic
1163958282 19:20664207-20664229 AGAGTGTCCGCTCCTTCCTCTGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165080950 19:33305691-33305713 ACCCTGCCCGCTCATTACTGGGG - Intergenic
1168551928 19:57303154-57303176 ACAGTGTCAGCTCCTTCCTCAGG + Intergenic
927368428 2:22326499-22326521 ACGGTATCCGCAAAGTCCTGAGG - Intergenic
937451252 2:122003466-122003488 ATGGTGTCCGTTTATTTCTGAGG - Intergenic
942998343 2:182293574-182293596 ATAGTGTCCCCTCATTCGTGGGG + Intronic
943519346 2:188928726-188928748 ACGGTGTCCCGTAATTCCTATGG + Intergenic
948797032 2:240410744-240410766 ACGGTGTCTCCTCTTTCCTGGGG - Intergenic
1184958962 22:47914948-47914970 ACTGTGACCCCTCATTCTTGGGG - Intergenic
955000935 3:54927430-54927452 GGGGTGTCCGTTCATTACTGAGG - Intronic
962963729 3:140334903-140334925 ACGATGACCGCACATTCCTGAGG - Intronic
964313437 3:155418512-155418534 ACGTTGGCCTCCCATTCCTGGGG - Intronic
964445170 3:156750753-156750775 GTGGTGGCCTCTCATTCCTGTGG + Intergenic
970221489 4:13816512-13816534 GCAGTGTCAGCTCATACCTGAGG - Intergenic
981230119 4:142343231-142343253 ATGGTCTCAGTTCATTCCTGTGG + Intronic
988282481 5:29167913-29167935 ACGGTGTGCGCTCAATTCTTAGG - Intergenic
992582988 5:78201023-78201045 ACTGTGTCCGCATATTCCTAGGG - Intronic
995182704 5:109244057-109244079 ACGTTGTCAGATCATCCCTGGGG + Intergenic
998128739 5:139640585-139640607 AGGGTGTGCCCTCATTCCTGGGG + Intergenic
1002351854 5:178589364-178589386 ACGGTGACCGCTCAGTCTTGGGG + Intronic
1002431672 5:179207713-179207735 ACGGTGTCCTCTCCTTGCAGGGG - Exonic
1003179657 6:3780805-3780827 CCAGTCTCTGCTCATTCCTGTGG - Intergenic
1017115038 6:150968120-150968142 ACGGGGGCTGCACATTCCTGTGG - Intronic
1018693059 6:166364552-166364574 ACGGGATCAGCCCATTCCTGTGG + Intergenic
1019493393 7:1325332-1325354 ACGGTGACGGCCAATTCCTGTGG + Intergenic
1020474314 7:8577902-8577924 AAGGTGTCTGCTCACTCATGTGG - Intronic
1024457320 7:49624136-49624158 TCTGTGTGTGCTCATTCCTGAGG - Intergenic
1039453307 8:37692922-37692944 ATGGTGGCCGCTCATTCCCAGGG + Intergenic
1044840574 8:96333430-96333452 ACGGTGTGCTCTGATTCCTTTGG + Intronic
1049188074 8:141269863-141269885 ACGGTGTCCGCTCATTCCTGGGG - Intronic
1049606456 8:143531497-143531519 ACTGTGGCCGCTCACGCCTGGGG - Intronic
1052237933 9:26235071-26235093 GGGGTGCCCCCTCATTCCTGAGG - Intergenic
1061581345 9:131538676-131538698 ACTGTGTCCGCACACCCCTGGGG + Intergenic
1062528024 9:136986026-136986048 GCGGTGTCCGCTGAAGCCTGGGG - Intronic