ID: 1049189171

View in Genome Browser
Species Human (GRCh38)
Location 8:141277082-141277104
Sequence CGGGCTCCTCACCCCTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 3, 2: 2, 3: 24, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049189171_1049189180 16 Left 1049189171 8:141277082-141277104 CCGGCACAGGGGTGAGGAGCCCG 0: 1
1: 3
2: 2
3: 24
4: 151
Right 1049189180 8:141277121-141277143 TGGGTGCGCCACGATGGCAACGG No data
1049189171_1049189175 -3 Left 1049189171 8:141277082-141277104 CCGGCACAGGGGTGAGGAGCCCG 0: 1
1: 3
2: 2
3: 24
4: 151
Right 1049189175 8:141277102-141277124 CCGCGCCGCCCTCTACAGATGGG No data
1049189171_1049189173 -4 Left 1049189171 8:141277082-141277104 CCGGCACAGGGGTGAGGAGCCCG 0: 1
1: 3
2: 2
3: 24
4: 151
Right 1049189173 8:141277101-141277123 CCCGCGCCGCCCTCTACAGATGG No data
1049189171_1049189179 10 Left 1049189171 8:141277082-141277104 CCGGCACAGGGGTGAGGAGCCCG 0: 1
1: 3
2: 2
3: 24
4: 151
Right 1049189179 8:141277115-141277137 TACAGATGGGTGCGCCACGATGG No data
1049189171_1049189181 17 Left 1049189171 8:141277082-141277104 CCGGCACAGGGGTGAGGAGCCCG 0: 1
1: 3
2: 2
3: 24
4: 151
Right 1049189181 8:141277122-141277144 GGGTGCGCCACGATGGCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049189171 Original CRISPR CGGGCTCCTCACCCCTGTGC CGG (reversed) Intronic
900481100 1:2899742-2899764 CAGCCGCCTCACCACTGTGCAGG + Intergenic
900572463 1:3365320-3365342 CTGGTTCCCCACCCCTGGGCTGG + Intronic
900659889 1:3777055-3777077 AGGGGTCCTCACCCCAGGGCTGG + Intergenic
900792775 1:4690922-4690944 CTGACTCCTATCCCCTGTGCTGG + Intronic
901980914 1:13033422-13033444 CGGGCTGGTCACCCCTATGGGGG - Intronic
902001174 1:13195509-13195531 CGGGCTGGTCACCCCTATGGGGG + Intergenic
902020407 1:13341213-13341235 CGGGCTGGTCACCCCTATGGGGG + Intergenic
903222366 1:21875968-21875990 CGGGCTCCACACCCCTGCACGGG - Exonic
904192626 1:28758812-28758834 CCCTCTCCTCACCACTGTGCAGG - Intronic
905086444 1:35382696-35382718 CGGCCTCCCAATCCCTGTGCTGG + Intronic
905267551 1:36765161-36765183 AGTGCTCCTCCCCACTGTGCTGG + Intergenic
905541859 1:38766266-38766288 CAGGCTCCTTGCCCCTGTGAAGG - Intergenic
906286088 1:44588755-44588777 CACCCTCCTCACACCTGTGCTGG - Intronic
907689202 1:56645490-56645512 CGCGCTCCGGACCGCTGTGCGGG + Intronic
908845455 1:68320161-68320183 TGGGATGCTGACCCCTGTGCGGG - Intergenic
912486792 1:110035126-110035148 CCGACTCCTCACCCCCGAGCTGG - Intronic
913518288 1:119623394-119623416 AGGGCTTCTCGCCCGTGTGCAGG + Exonic
918002306 1:180508965-180508987 CGGGCTCCTCAGCCCTTGGGCGG - Intergenic
920074261 1:203325370-203325392 CCTGCTCCTCATCCCAGTGCAGG - Intergenic
922200146 1:223394167-223394189 CGGGCTCCGCATCTCTTTGCTGG - Exonic
922769925 1:228176186-228176208 CTGGCTCCTGAGCCCTGCGCTGG - Exonic
922854597 1:228763671-228763693 CAGTCTCCTCAATCCTGTGCTGG + Intergenic
1062981078 10:1723631-1723653 AGGGCTGCTGTCCCCTGTGCAGG - Intronic
1067414664 10:46094315-46094337 CTGCATCCTCACCCCTGGGCTGG - Intergenic
1068526294 10:58134093-58134115 CTGGCTCCTCTCTCCTCTGCAGG - Intergenic
1069901077 10:71707059-71707081 CGGCCTCCGCCCACCTGTGCAGG + Intronic
1070769051 10:79071627-79071649 CTGGCTCCTGGCCCCAGTGCAGG + Intronic
1071773373 10:88755565-88755587 CTAGCTCCTCACCCCTGAGTTGG - Intergenic
1072615764 10:97048090-97048112 TGGGCTCCTCAGCCCTGTCTGGG - Intronic
1072910798 10:99499091-99499113 GGGGCTGATCACCCCTGTGGAGG + Intergenic
1074492908 10:113955195-113955217 CTGGCCCCTCTCCCCTGTGAGGG + Intergenic
1074877600 10:117626185-117626207 CCCTCTCCTCACCCCTGTTCTGG + Intergenic
1075671792 10:124268062-124268084 CAGGCTCCTTCCTCCTGTGCAGG - Intergenic
1076270648 10:129149516-129149538 GTGGCTCCTTACCCCTGTGCCGG + Intergenic
1076373461 10:129968848-129968870 CGGGCGCCTCCTCCCTGCGCTGG + Intergenic
1077369671 11:2175617-2175639 AGGGCTCCTCAGACCTCTGCGGG - Intergenic
1079453747 11:20619500-20619522 AGGTCTCCTCACTCCTGGGCTGG - Intronic
1080385965 11:31811477-31811499 CCGGCTCCTCTCCCCGGCGCAGG + Intronic
1080828524 11:35868784-35868806 CTGTCTCTTCTCCCCTGTGCTGG - Intergenic
1081675570 11:44967098-44967120 AGGGCTCCAGACCCCTGTGCAGG - Intergenic
1081738503 11:45421859-45421881 CTGGCTCCACACCCCTGTTCTGG - Intergenic
1083857609 11:65400883-65400905 CAGCCTCCCCACCCGTGTGCAGG - Intronic
1084151498 11:67289725-67289747 TGGCCTCCTCTCCCCTGCGCTGG + Intronic
1084386760 11:68847971-68847993 CTTGCTCCTGACCGCTGTGCTGG + Intergenic
1087125755 11:94624376-94624398 TGGTCTCATCACCCCTGTGGTGG - Intergenic
1087204699 11:95381737-95381759 TGGGCTACTCACCCCTGTTACGG + Intergenic
1089695129 11:120211920-120211942 CTGGCTTCTCACCCCTGTACAGG + Intronic
1091297906 11:134486660-134486682 CACTCTCCTCACCCCAGTGCAGG - Intergenic
1091704799 12:2686417-2686439 AGGGCTTCACACTCCTGTGCAGG + Intronic
1091770331 12:3147264-3147286 CGGGCTCCTCATCCCAGGGCAGG - Intronic
1098223636 12:68298008-68298030 CTGGCTTCTCACACCTGGGCAGG - Intronic
1104035704 12:125095826-125095848 GGTGCTCCTCACCACTGTGCTGG - Intronic
1113140092 13:107138015-107138037 TGAGCTCCTCACCCCCATGCTGG - Intergenic
1113401136 13:109994339-109994361 CTGGACCCTCACCACTGTGCAGG + Intergenic
1114619715 14:24088136-24088158 TGGACTCCTCACCCATGTGGTGG - Intronic
1118370468 14:65133373-65133395 GGGGCCCCTCACACCTGTGGTGG - Intergenic
1119106682 14:71932023-71932045 CGGGCACCTCACCCCGGGCCGGG + Intergenic
1119548056 14:75487722-75487744 CCGGCTCCTCACCCCTGTGCTGG + Intergenic
1119548087 14:75487902-75487924 CCGGCTCCTCACCCCTGTGCTGG + Intergenic
1119548117 14:75488082-75488104 CCGGCTCCTCACCCCTGTGCTGG + Intergenic
1122116072 14:99527883-99527905 CGGGGTCCTCCCGCCTCTGCAGG - Intronic
1128735599 15:70052236-70052258 AGGCCTCCTGACCCCTGAGCTGG - Intronic
1129660230 15:77549229-77549251 CGGCCTCCTCATCCCTGGGCAGG - Intergenic
1130223313 15:82039607-82039629 AGGGCTTCTCATCCCTGAGCTGG + Intergenic
1130647272 15:85740251-85740273 CGAGCTCCTCAGCGCTCTGCAGG + Exonic
1132548730 16:545466-545488 CGCCCTCCTCACCCGTGTCCCGG + Intronic
1134090079 16:11386903-11386925 CACCCTCCTCACCCCTCTGCAGG + Intronic
1134124159 16:11605076-11605098 TGGGTCCCTCACCCGTGTGCAGG + Intronic
1138599196 16:58045170-58045192 CGGGCTCTGCACCCCCGTGGGGG - Exonic
1139471951 16:67183189-67183211 TGGACTCCTCACCCCTTTACAGG + Intronic
1139603118 16:67998577-67998599 CGCACTCCTCAGCCCTGTGGTGG - Intronic
1139718487 16:68833515-68833537 CGGGCCCCAGACCCATGTGCTGG + Exonic
1142442319 16:90106727-90106749 CGGCCTCCTCAGCACTGAGCCGG - Intergenic
1143032933 17:3977726-3977748 CAGGCTCGTAACCTCTGTGCTGG + Intergenic
1146526844 17:33574060-33574082 AGAGCTCCTCCTCCCTGTGCAGG - Intronic
1146722052 17:35130558-35130580 TGGGCACCCCACCCCTGGGCTGG + Exonic
1152603971 17:81279476-81279498 TGACCTCCCCACCCCTGTGCCGG - Intronic
1155382963 18:25244803-25244825 CTGTCTCCTCACCCCATTGCTGG + Intronic
1158012116 18:52741051-52741073 AGGTCTCCTGACCCTTGTGCTGG + Intronic
1160432030 18:78819211-78819233 GGGGCTCATCCCCCCTGTACTGG - Intergenic
1160432067 18:78819297-78819319 GGGGCTCATCCCCCCTGTACTGG - Intergenic
1161028941 19:2049173-2049195 CGGCCTCCTCGCCCGTGTACAGG + Intronic
1161042547 19:2117674-2117696 CGGGCTCCCCGCCTCTGTGCTGG + Intronic
1161408474 19:4103175-4103197 TGGTCTCCTCGCCACTGTGCCGG + Intronic
1161911833 19:7199668-7199690 TGGGTTCCTCACGCCTGTGATGG - Intronic
1163666239 19:18605382-18605404 CAGGCTCATCCACCCTGTGCTGG - Intronic
1164156800 19:22602132-22602154 CTGGATCCTCACCCCTTTCCTGG + Intergenic
1164669871 19:30066441-30066463 TCAGCTCCTCACCCCGGTGCAGG + Intergenic
1165305268 19:34999701-34999723 TGCGCTCATCACCCCAGTGCTGG - Intronic
1166230386 19:41422976-41422998 GGGGCCCCTTGCCCCTGTGCAGG + Exonic
1166671278 19:44710848-44710870 CGTGCTCCACACCCCACTGCTGG + Intergenic
1167331408 19:48858868-48858890 TGGGCTCCTGACTCCAGTGCTGG + Exonic
1167609704 19:50501252-50501274 CGGGCTCCCCACGCCTCTGCTGG - Intergenic
925225816 2:2183329-2183351 GAGGCTGCTCACCTCTGTGCAGG + Intronic
925407589 2:3616022-3616044 GGGGCTCCTCACCTCTGAGGCGG + Intronic
925477322 2:4231962-4231984 CAGCCCCCTCACCCCTGGGCAGG - Intergenic
926231551 2:11008053-11008075 CGAGCTGCTCACCCGTCTGCTGG - Intergenic
926741234 2:16112332-16112354 CTGTCTCCTCAGCCCTGTTCTGG - Intergenic
927382291 2:22492912-22492934 CAGGCTCCTCTCCCCTGTTCTGG - Intergenic
929763654 2:44826442-44826464 CAGGCCCCTCACCCCAGTGGCGG + Intergenic
934107702 2:88710886-88710908 TGGTCTGCTCACCCCTGAGCTGG + Intronic
934695868 2:96399802-96399824 CTGGCTCCTCAGCCTTGAGCAGG - Intergenic
937251290 2:120525425-120525447 CCGGCTCATCAGCCCTCTGCTGG + Intergenic
937875560 2:126823015-126823037 GGGGCTCCTCCTCCCTGTCCAGG + Intergenic
938971938 2:136440477-136440499 CGGGCTGCTCACCTCTGTGCTGG + Intergenic
939522428 2:143247311-143247333 CGGGCTCCACAGCCCAGTGGCGG - Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947705667 2:232273606-232273628 CTGGCTCCTCACACCTGTTCAGG - Intronic
948161302 2:235827041-235827063 GGAGCTCTTCACCCCTGGGCGGG + Intronic
948612376 2:239178134-239178156 AGAGCTCCTCACACCTGTGGAGG - Intronic
1171216279 20:23354844-23354866 CCTGATCCTCACCCCTGTGCGGG - Intergenic
1171280276 20:23890308-23890330 CTGCCTCCTCACCCCTTTCCTGG + Intergenic
1172086932 20:32392560-32392582 CGGGCAGATCACGCCTGTGCTGG + Intronic
1172166931 20:32905176-32905198 CTGAATCCTGACCCCTGTGCGGG + Intronic
1173026377 20:39311041-39311063 CGGTCTCCTCAGCCCTGGGCTGG + Intergenic
1175133356 20:56805985-56806007 GGGGCTCGACACCCCTGGGCAGG + Intergenic
1182027197 22:27129569-27129591 CTGGCTCCTAACCACTGTGCAGG + Intergenic
1182372943 22:29825011-29825033 CGGGCTCTCCACCCCTGGGAAGG - Intronic
1182547575 22:31084928-31084950 CGGGCTCCTCCCCGCGGGGCCGG + Intronic
1183386749 22:37519398-37519420 CGGGCACCGCCCCCCTGCGCCGG - Exonic
1183947979 22:41337681-41337703 CAGGGTCCTCACCCCGGTGAAGG - Intronic
1183963687 22:41428452-41428474 CTGGCTCCTGAGCCCTGTGGAGG - Intergenic
1185394161 22:50578314-50578336 CGCCGTCCTCGCCCCTGTGCAGG + Intronic
950494304 3:13324462-13324484 CAGGCTCCTCACCTCCCTGCAGG + Intronic
954293784 3:49663123-49663145 CCGGCTCCTCACCAGTGTGGCGG - Exonic
958824790 3:99017402-99017424 TGGCTTCCTCACCCTTGTGCTGG + Intergenic
961358167 3:126351872-126351894 AGGGCTTCTCACCCGTGTGCCGG + Exonic
961558991 3:127715959-127715981 GGGGCTCCTCTCTCCTGAGCTGG - Intronic
961749010 3:129084757-129084779 CGGCCTCCTCTGCCATGTGCTGG + Intergenic
963870336 3:150408850-150408872 CGGGCTCCTCAGGCCGGTGCCGG - Exonic
966928402 3:184660162-184660184 CAGGCTCCACGCCCCTGTGCAGG - Intronic
968121447 3:196128751-196128773 CAAGCTCCTCACCCCTGACCTGG + Intergenic
968318266 3:197742688-197742710 TGGGCTCCTCATCCCAGAGCAGG + Intronic
968362591 3:198157691-198157713 CGGCCTCCTCAGCACTGAGCCGG - Intergenic
969537060 4:7762854-7762876 CTGGCTCCTCGCCGCTGTACAGG - Exonic
969632588 4:8347093-8347115 AGGGCTCCTGTCCCCTGGGCTGG + Intergenic
980977609 4:139625779-139625801 TGGTAACCTCACCCCTGTGCTGG - Intergenic
982105447 4:152008042-152008064 CTGGCTCATCACCACTGGGCTGG + Intergenic
984964278 4:185127491-185127513 CGCGGTCCTCACCGCGGTGCCGG - Intergenic
986748668 5:10765450-10765472 CAGGCTCCTCTCCCCTGTAAAGG - Intergenic
989115165 5:37945524-37945546 TGGGCTCCTGACACCTGTGATGG - Intergenic
997697292 5:135871735-135871757 CTGGAGCCGCACCCCTGTGCAGG + Intronic
997990658 5:138542622-138542644 CGGGCCCCTTACCCCCATGCGGG + Intronic
1001223392 5:169923129-169923151 TATGCTCCTCACCTCTGTGCTGG + Intronic
1001430474 5:171657514-171657536 CAGCCTCCTCACCCCTCTGTTGG + Intergenic
1002087007 5:176782171-176782193 CGGGCCCCTCCCCTCTGTGCAGG - Intergenic
1003148936 6:3532420-3532442 CTGGAACCTAACCCCTGTGCAGG - Intergenic
1006442224 6:34059790-34059812 TGGGCTCCTCAGCCCCGGGCTGG - Intronic
1019267332 7:125210-125232 CTGGCCCCTCCACCCTGTGCTGG + Intergenic
1019370388 7:660134-660156 TGGGCTCCTCCCCTCTCTGCAGG - Intronic
1019735709 7:2648903-2648925 CGGGCCCCACACCCCACTGCAGG - Intronic
1019735716 7:2648922-2648944 CGGGCCCCACACCCCACTGCGGG - Intronic
1019735724 7:2648941-2648963 CGGGCCCCACACCCCACTGCGGG - Intronic
1024301201 7:47889022-47889044 ATGGCTCCTCAGCCCTGTGCTGG - Intronic
1026910786 7:74090676-74090698 AGGGCCCCTCACCCCTCTGAAGG + Intronic
1032889041 7:136173999-136174021 CTGGTTTCTCACCCCTCTGCGGG + Intergenic
1033220466 7:139523874-139523896 TGGGCCCCGCACCCCGGTGCAGG + Exonic
1035731069 8:1853846-1853868 GTGGCTCCTCGTCCCTGTGCTGG + Intronic
1037069899 8:14631189-14631211 CAGACTCCTCACCCCTGAGGAGG - Intronic
1043502836 8:80873912-80873934 CGGGCTCCCGCCCCCTGTCCCGG - Intronic
1044666554 8:94639531-94639553 CGGGCTCCTCTCCCCCCTCCCGG + Intergenic
1047914985 8:129573483-129573505 CAGGCTGCTCACCCCTGTGCAGG + Intergenic
1048294335 8:133203232-133203254 AGGGCTCCTCACTCCTCTTCTGG + Intronic
1048303513 8:133267783-133267805 CCAGGTCCTCACCCCTGAGCTGG + Intronic
1049189171 8:141277082-141277104 CGGGCTCCTCACCCCTGTGCCGG - Intronic
1049393285 8:142382929-142382951 CAGGCTCTTCACCACTGTGCTGG + Intronic
1049744094 8:144255836-144255858 CTGGCGCCTCACCCAGGTGCAGG + Intronic
1053367052 9:37530354-37530376 GGAGCTCTTCAGCCCTGTGCGGG - Intronic
1058692113 9:107528652-107528674 AGGGCTCCTCAACCTAGTGCTGG + Intergenic
1058866753 9:109167644-109167666 CTGCCTCCTCAACCTTGTGCCGG + Intergenic
1060390009 9:123269048-123269070 CGGGCCCCGCACCCCAGTGCGGG + Intergenic
1060902698 9:127274630-127274652 CAGGCTCCTCAACCTTATGCTGG + Intronic
1061207592 9:129173824-129173846 AGGGCTCCCCTCCCCTCTGCCGG - Intergenic
1061289963 9:129645125-129645147 CGGTCTCCTCACCTATGTGATGG + Intergenic
1061674675 9:132209014-132209036 CGGGCTCCTCACTCCTGAGTAGG + Intronic
1062536152 9:137021929-137021951 AGGGCTCCTGACCCTTGTGGAGG + Exonic
1062747279 9:138221350-138221372 CGGCCTCCTCAGCACTGAGCCGG - Intergenic
1187254362 X:17628706-17628728 TGGGCTCCTGACCACTATGCTGG - Intronic
1191006768 X:55717949-55717971 CGCGGTCCTCACCTCTTTGCGGG + Exonic
1196911278 X:120487006-120487028 AGGGTTCCTGACCCCTGTGCCGG - Intergenic
1201014847 Y:9590417-9590439 CTGACTCCTGACCCCTGAGCAGG + Intergenic