ID: 1049190941

View in Genome Browser
Species Human (GRCh38)
Location 8:141287032-141287054
Sequence GCGACTTCCTCAAGGTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 2, 2: 31, 3: 163, 4: 680}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049190941_1049190949 11 Left 1049190941 8:141287032-141287054 CCGTGTGACCTTGAGGAAGTCGC 0: 1
1: 2
2: 31
3: 163
4: 680
Right 1049190949 8:141287066-141287088 AGGTCATGTGCGAGGCCTTAGGG No data
1049190941_1049190943 -9 Left 1049190941 8:141287032-141287054 CCGTGTGACCTTGAGGAAGTCGC 0: 1
1: 2
2: 31
3: 163
4: 680
Right 1049190943 8:141287046-141287068 GGAAGTCGCCTGACCGCTCCAGG No data
1049190941_1049190948 10 Left 1049190941 8:141287032-141287054 CCGTGTGACCTTGAGGAAGTCGC 0: 1
1: 2
2: 31
3: 163
4: 680
Right 1049190948 8:141287065-141287087 CAGGTCATGTGCGAGGCCTTAGG No data
1049190941_1049190945 3 Left 1049190941 8:141287032-141287054 CCGTGTGACCTTGAGGAAGTCGC 0: 1
1: 2
2: 31
3: 163
4: 680
Right 1049190945 8:141287058-141287080 ACCGCTCCAGGTCATGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049190941 Original CRISPR GCGACTTCCTCAAGGTCACA CGG (reversed) Intronic
900099489 1:955350-955372 TCCACTGCCTCAAGGTCACATGG + Intronic
900850776 1:5141217-5141239 GTGACTCGCTGAAGGTCACAGGG + Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901197420 1:7447902-7447924 GCTATTTGCCCAAGGTCACATGG + Intronic
901797718 1:11690502-11690524 GCGACTTGCTCGAGGTCATAGGG + Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
902775082 1:18669483-18669505 GTGACTTGCTAGAGGTCACACGG - Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
902883614 1:19389399-19389421 ACTACTTCCTAAAGGTTACATGG + Intronic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903461237 1:23522242-23522264 GTGACTTGCTTAAGGTCTCACGG + Intronic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903954465 1:27015492-27015514 GGGACTTCCCCAAGGTCACGTGG - Intergenic
903971156 1:27119681-27119703 GCAACTTGATCAAAGTCACATGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904318691 1:29682542-29682564 GTGGCTTCTTCAAGGTCATATGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
904900987 1:33856833-33856855 GCCACCTCTCCAAGGTCACATGG - Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905242423 1:36589486-36589508 GCCACTTGCATAAGGTCACAGGG + Intergenic
905334264 1:37233348-37233370 GCGGCTTGCTCAAGGTCATTTGG - Intergenic
905486367 1:38299787-38299809 ACAACTTGCTCAAGGTCCCATGG + Intergenic
905850154 1:41267995-41268017 GTGACTTGCTTAAGGTCACTGGG - Intergenic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
906041164 1:42788755-42788777 GATACTTGCTCAAAGTCACATGG - Intronic
906227150 1:44131457-44131479 AGAACTTTCTCAAGGTCACATGG - Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906800339 1:48731674-48731696 GCAAATTCCCCAAGGTGACAGGG + Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907274643 1:53310393-53310415 ATGACTTCCTCCAGGTCACACGG - Intronic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907329043 1:53659496-53659518 AGGACTTCCTCAAGGTCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907492390 1:54816373-54816395 GCAACTTGCCCAAGGTAACACGG - Intronic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
907637248 1:56147889-56147911 GAGCTTTCCTCAAAGTCACATGG + Intergenic
907754139 1:57293560-57293582 GCCACTTGCTCAAGGCCACCTGG + Intronic
907896698 1:58699570-58699592 ACGACTCGCCCAAGGTCACACGG + Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908358509 1:63345236-63345258 GTGACTTGCTCAAAGGCACATGG - Intergenic
910106331 1:83634848-83634870 ATGACTTGCTCAAGGTCGCATGG + Intergenic
911244497 1:95501733-95501755 GTGACTTGCTCAGAGTCACATGG - Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913179313 1:116305049-116305071 GCGAATTCCTCAACTTCATATGG - Intergenic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
914433180 1:147638343-147638365 GTCACTTGCTCAAGGTCATATGG + Intronic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
917259451 1:173150949-173150971 GTGACTTTCACAAAGTCACATGG + Intergenic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
918094281 1:181321830-181321852 CCGATTTGCACAAGGTCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
918854915 1:189739790-189739812 GAGAATTCCTCAAGGTCAAAAGG - Intergenic
919688702 1:200508830-200508852 GCAACGTGTTCAAGGTCACAGGG - Intergenic
919813758 1:201425065-201425087 TCGATTTCCTCACGGGCACATGG - Intronic
920044926 1:203127012-203127034 GGGACTTCCGGAGGGTCACAGGG - Intronic
920678878 1:208057973-208057995 GTGACTTGCTCAAAGTCACCTGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921432226 1:215078821-215078843 GTGACTTCTTCAAATTCACATGG + Intronic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
1063571235 10:7216096-7216118 GCAACGTGCTCAAGGCCACAGGG + Intronic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1065654242 10:27930718-27930740 GTAACTTCCTTAAAGTCACAAGG - Intronic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067558056 10:47285935-47285957 GCTCCTTCCTCAAGGCTACAGGG - Intergenic
1068774255 10:60854073-60854095 TCAAGTTCCTCAGGGTCACAGGG - Intergenic
1069836114 10:71309197-71309219 GCAATTGGCTCAAGGTCACATGG - Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070179284 10:73998528-73998550 AGGACTCGCTCAAGGTCACAGGG - Intronic
1070492423 10:76990111-76990133 GGAACTTACTCAAAGTCACATGG + Intronic
1070563463 10:77585277-77585299 GCGACTTGCTTCAGGTCACCCGG - Intronic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070770478 10:79079602-79079624 GCGACTTGACCAAGGCCACAGGG + Intronic
1070795184 10:79212113-79212135 GTGACTTGCTTAAGGTCACGTGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071514243 10:86286680-86286702 GTAACTCCCTCACGGTCACATGG - Intronic
1071837867 10:89437470-89437492 GTGACTTTCTGTAGGTCACAGGG + Intronic
1071942158 10:90601790-90601812 GAGACTTACTCACTGTCACAAGG - Intergenic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072555287 10:96510073-96510095 ATGACTTGCTCAAGGCCACACGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1072835896 10:98711544-98711566 ACAACTTACCCAAGGTCACATGG - Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073290904 10:102412822-102412844 GCTGCTTCCTCAAGCTCCCAGGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073604638 10:104881821-104881843 GTGGCTTCTCCAAGGTCACATGG - Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1073710369 10:106030026-106030048 GCGAATTGCACAAAGTCACATGG - Intergenic
1073807259 10:107110791-107110813 GTGACTTCCTCCAGGTCCCTGGG - Intronic
1073889184 10:108078409-108078431 GCAATTTCCTCAAAGTCATAAGG - Intergenic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074431328 10:113397382-113397404 GCCACTTCCTCACAGTCCCATGG - Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075193687 10:120335365-120335387 GCAATTTGGTCAAGGTCACATGG - Intergenic
1075466724 10:122656995-122657017 GAGACTTACCCAAAGTCACAGGG - Intergenic
1075468782 10:122672393-122672415 GAGACTTTCCCAAAGTCACAGGG - Intergenic
1075701632 10:124473532-124473554 GGGACTTCCTTGAGGCCACATGG - Intronic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076531639 10:131149064-131149086 GCGACCTTCTCAGGGTCACCTGG - Intronic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1078107347 11:8366545-8366567 GCCACTTGCCCAAGGTCACTTGG - Intergenic
1078753699 11:14188734-14188756 AGGACTTTCCCAAGGTCACATGG - Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079989576 11:27232636-27232658 GTGACTTGCTCATGGTCACTTGG + Intergenic
1080008465 11:27433855-27433877 GGGACTTGCTTCAGGTCACATGG - Intronic
1080570554 11:33552843-33552865 GAAACTTCCAGAAGGTCACACGG + Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081742727 11:45452203-45452225 GAGGCTTTCCCAAGGTCACAGGG + Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1082174111 11:49042060-49042082 GCAACTTCAGCAAAGTCACAGGG - Intergenic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083445525 11:62705994-62706016 GCGACTTGCCTAAGGTCGCACGG + Intronic
1083655173 11:64226041-64226063 CAGACTTGCCCAAGGTCACACGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083925359 11:65802901-65802923 CCATCTTGCTCAAGGTCACACGG + Intergenic
1083949328 11:65945428-65945450 GGGACTTACACCAGGTCACACGG + Exonic
1084199628 11:67547077-67547099 GCATCTAGCTCAAGGTCACATGG - Intergenic
1084773523 11:71359746-71359768 GGGGCCTCCTCAAAGTCACATGG - Intergenic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1086356537 11:86007016-86007038 GTAACTTCCCCAAAGTCACAGGG + Intronic
1086691659 11:89794025-89794047 GCAACTTCAGCAAAGTCACAGGG + Intergenic
1086714144 11:90045629-90045651 GCAACTTCAGCAAAGTCACAGGG - Intergenic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088727637 11:112653671-112653693 GAGACTTGCTCAGGGTGACATGG + Intergenic
1088807721 11:113367291-113367313 GCAACTTGCCCAAAGTCACATGG - Intronic
1088819834 11:113447753-113447775 GCCACTTGCTTGAGGTCACATGG - Intronic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089203424 11:116739394-116739416 GGGGCTTCCTCAAGGTCTCATGG + Intergenic
1089256850 11:117198743-117198765 GCGTCTTCCTCAAGGCCACATGG - Intergenic
1089503666 11:118948596-118948618 ATGACTTTCCCAAGGTCACAGGG - Intronic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1089975579 11:122728935-122728957 GAGACTTGCTCAAGGCCACCCGG + Intronic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090735009 11:129605061-129605083 ACAACTTGGTCAAGGTCACATGG + Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091182993 11:133624094-133624116 ATCACTTCTTCAAGGTCACAGGG - Intergenic
1091281672 11:134385051-134385073 GCAGCTTGCTCAAGGGCACAGGG - Intronic
1091402690 12:190197-190219 GGGACTTTTTCAAGTTCACATGG - Exonic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092275483 12:7057834-7057856 GTAACTTTTTCAAGGTCACACGG + Intronic
1092765736 12:11851041-11851063 GGGACTTGTTCAAGGTCACCTGG + Intronic
1092978377 12:13768556-13768578 GGGTCTTCCTCAAGGACATATGG - Intronic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1093491600 12:19711017-19711039 GTGACTCTCTCAATGTCACATGG + Intronic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096244788 12:49978399-49978421 TTGACTTGCTCAAGGTCACCTGG + Intronic
1096430586 12:51539713-51539735 GTAACTTTCTCAGGGTCACACGG - Intergenic
1096437264 12:51604434-51604456 GCGCCTTCCTCAATACCACACGG + Intronic
1096536333 12:52277510-52277532 TTGACTTCCTCTAGTTCACAGGG - Intronic
1096676326 12:53228072-53228094 GTGACTGGCTTAAGGTCACATGG + Intronic
1097289549 12:57902872-57902894 CTGACTTGCTCCAGGTCACAGGG + Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1097697344 12:62787282-62787304 TCCCCTTCCTCTAGGTCACATGG - Intronic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101676351 12:106920406-106920428 ATGACTTCCCCCAGGTCACATGG + Intergenic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102230846 12:111261188-111261210 GCCACTTGCCCAAGGTCACCCGG - Intronic
1102232991 12:111276531-111276553 CCCACTTGCTCAAGGTCACTAGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102403024 12:112647303-112647325 GAGACTCGCTCAGGGTCACATGG - Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102552747 12:113703475-113703497 GCAACTGGCCCAAGGTCACAAGG - Intergenic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102846456 12:116189889-116189911 GTGAGTTCAGCAAGGTCACAGGG - Intronic
1102920373 12:116787322-116787344 GCGACTTGCTCAAGGCACCATGG - Intronic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104543550 12:129689180-129689202 CTGACTTCTCCAAGGTCACATGG + Intronic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105422375 13:20264499-20264521 GGAACTTCCCCAAGGCCACATGG + Intergenic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1108014356 13:46058611-46058633 GCCACTTTCTCAAGGTTGCAAGG - Intronic
1108130621 13:47295946-47295968 GCAACTTCAGCAAGGTCTCAGGG + Intergenic
1108178668 13:47819879-47819901 GTAACTTCCACAGGGTCACATGG - Intergenic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1108713525 13:53057083-53057105 GAGACTTCATCAGAGTCACATGG + Intergenic
1109374102 13:61466669-61466691 GAGTCTTCCTAATGGTCACATGG - Intergenic
1111813584 13:93122001-93122023 GTAACTTCCTTAAAGTCACATGG - Intergenic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112455798 13:99561859-99561881 GTGACTGTCTCATGGTCACATGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1113738412 13:112694157-112694179 GCCACTTGCCCAAGGCCACATGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115325018 14:32128447-32128469 GGGACTTTCTCAGGGTCTCATGG - Intronic
1116057305 14:39879665-39879687 AAGACTTGCCCAAGGTCACAGGG + Intergenic
1116308706 14:43292963-43292985 GCAAATTCCTCAAGGTGAAAGGG + Intergenic
1116772482 14:49143505-49143527 ATCACTTCCTCAAGGTCATATGG - Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117012846 14:51488443-51488465 GGGATTTATTCAAGGTCACATGG + Intergenic
1118170752 14:63386385-63386407 GCCATTGGCTCAAGGTCACATGG + Intronic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119481800 14:74962652-74962674 AAGACTTGCCCAAGGTCACACGG - Intergenic
1119690640 14:76669358-76669380 CTGACTTGTTCAAGGTCACAGGG - Intergenic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120341964 14:83232473-83232495 GTGACTTGGTCAAGGTCATATGG - Intergenic
1120465928 14:84857322-84857344 GTAAATTCCCCAAGGTCACAGGG + Intergenic
1120531793 14:85640928-85640950 GCAACTTGCCCAAGGTCACGGGG - Exonic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121052334 14:90827749-90827771 ACGCCTTTCACAAGGTCACACGG - Intergenic
1121252808 14:92512681-92512703 GTGACTTGCTCAAGGCCATATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121436218 14:93921853-93921875 GAGACTTGCTGAAGGTCCCATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1121934346 14:98003366-98003388 GCAACTTCAGCAAGGTCTCAGGG + Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122261330 14:100524758-100524780 CGGATTTGCTCAAGGTCACAGGG - Intronic
1124018816 15:25901791-25901813 CTGACTTCCTCAAGGCCAGAAGG - Intergenic
1124134021 15:27018178-27018200 GTGACTTTCTCAAGGCCATATGG + Intronic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1125240552 15:37569750-37569772 GTGAATTCAGCAAGGTCACAGGG + Intergenic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126636760 15:50787704-50787726 GCTATTTTCTCATGGTCACAAGG - Intergenic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1126988117 15:54338750-54338772 GACATTTTCTCAAGGTCACAAGG + Intronic
1127540049 15:59928477-59928499 CAGTCTTCCTCAAGGTCTCAAGG + Intergenic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128171569 15:65517865-65517887 GCGACTTGCTGAAAGTCACAGGG + Intergenic
1128356371 15:66930354-66930376 GTGATTTCATGAAGGTCACAGGG - Intergenic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130661470 15:85834322-85834344 GTGACTTCTCCAAGGCCACACGG + Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1131480179 15:92774053-92774075 ATGACTTCCTCAAGGTCACTCGG + Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1133974681 16:10592049-10592071 TTGACTTGCTCAAGGGCACATGG + Intergenic
1133998758 16:10766581-10766603 GCGAGTTCCACATGGTCTCATGG + Intronic
1134129606 16:11640334-11640356 GTGACTTCACCGAGGTCACACGG + Intergenic
1134179929 16:12039350-12039372 GTGACTTGCTCAAGGTCATTTGG + Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134567199 16:15261844-15261866 GCCATTTGCTCAAGGTCAGAAGG + Intergenic
1134637313 16:15802366-15802388 GCAACTTGCCCAAGGTCACTAGG + Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134735292 16:16494856-16494878 GCCATTTGCTCAAGGTCAGAAGG - Intergenic
1134830058 16:17315744-17315766 GCAACTTGCCCAAGGTCACCTGG + Intronic
1134932230 16:18217361-18217383 GCCATTTGCTCAAGGTCAGAAGG + Intergenic
1135159958 16:20085331-20085353 GCGACTTGGTCAAGGTCACGCGG - Intergenic
1135165859 16:20138656-20138678 GAGATTTCTCCAAGGTCACATGG - Intergenic
1135306674 16:21373117-21373139 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136303416 16:29352259-29352281 GTGACTTGCTCAAGGTCATTTGG + Intergenic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1136694816 16:32068450-32068472 GCCACCTCCTCAGGGTTACAGGG + Intergenic
1136795317 16:33011712-33011734 GCCACCTCCTCAGGGTTACAGGG + Intergenic
1136874603 16:33842670-33842692 GCCACCTCCTCAGGGTTACAGGG - Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137693633 16:50446926-50446948 GACACTTCCTCAAGGTCACTTGG + Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1138428408 16:56951632-56951654 GTGACTTCCTCTAGGCCCCACGG - Intergenic
1138526230 16:57608972-57608994 GAGACTTGCCCAAGGTCACCCGG + Intergenic
1138956407 16:61975803-61975825 CTGAACTCCTCAAGGTCACAAGG + Intronic
1139236431 16:65344215-65344237 GCTACTTATTCAAGGTCATATGG + Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1139704898 16:68734571-68734593 CTGACTTCCCCAAGGTCACAGGG + Intergenic
1140279679 16:73543429-73543451 CAGGCTTCCTCCAGGTCACAAGG - Intergenic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141884294 16:86881138-86881160 GTGAATTCCTGAAGGTCACACGG + Intergenic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142121574 16:88389146-88389168 GTGACTTCTTCATGGGCACAGGG - Intergenic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1203097572 16_KI270728v1_random:1273372-1273394 GCCACCTCCTCAGGGTTACAGGG + Intergenic
1142750885 17:1986920-1986942 GAGATGTCCTCAAGGTCGCACGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143100577 17:4502595-4502617 GTGATGTCTTCAAGGTCACACGG - Intronic
1143100677 17:4503139-4503161 GACACTTACCCAAGGTCACACGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143355305 17:6323565-6323587 GTCACTTGCTGAAGGTCACAGGG + Intergenic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1143794287 17:9324059-9324081 AAGACTTGCTCAAGGTCTCAGGG + Intronic
1143849881 17:9802884-9802906 GCAACCAGCTCAAGGTCACATGG - Intronic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144224762 17:13134240-13134262 GTGACTTGTGCAAGGTCACATGG + Intergenic
1145812885 17:27775105-27775127 ACTAATTGCTCAAGGTCACATGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146076850 17:29738486-29738508 GAGACTTTCTCAAGGTCTCAAGG - Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1146931519 17:36781363-36781385 GCAACTTGCCCAAAGTCACACGG - Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1148546614 17:48524172-48524194 GCAACTTGCCCAAGGCCACAGGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149564832 17:57633684-57633706 ATGACTTGCTCAAGGCCACATGG - Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1151878373 17:76880237-76880259 GCGATTTCCTTAAAGACACAGGG - Intronic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152020557 17:77778265-77778287 GAGATTTCCCCGAGGTCACACGG + Intergenic
1152689825 17:81712803-81712825 GTGACTCCCCCAAGGTCACCAGG - Intronic
1152718763 17:81912265-81912287 GGGGCTTCCTCAAGGACAAATGG + Exonic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155140343 18:23038992-23039014 GCCACTTGCCCATGGTCACATGG - Intergenic
1155515269 18:26618131-26618153 AAGACTTGCTTAAGGTCACATGG - Intronic
1155557915 18:27042268-27042290 GTGACTTGGTCAAGGTCACTTGG - Intronic
1156083410 18:33368677-33368699 GCAACTTGTTCAAGCTCACAAGG - Intronic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1156596378 18:38552410-38552432 GAGGCTTATTCAAGGTCACATGG - Intergenic
1157298218 18:46461183-46461205 GGGACTTGCTCAAGGTCATTGGG - Exonic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1157634894 18:49142326-49142348 GTAACTTCCTCACTGTCACATGG + Intronic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1158706821 18:59800009-59800031 GGGACTTCTTCAAGGTCACCAGG - Intergenic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1163129459 19:15263586-15263608 GCCACTTCTCCATGGTCACATGG - Intronic
1163175924 19:15564057-15564079 GCGACATCCTGCAGGGCACACGG - Intergenic
1163497610 19:17655833-17655855 GGGGCTGCCACAAGGTCACAGGG - Intronic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1166849625 19:45753290-45753312 CCGACCCCCTCAAGGTCACTGGG - Intronic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167578842 19:50330524-50330546 GGCACTGCCTAAAGGTCACAGGG + Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
925738675 2:6986194-6986216 GTGACAGCCTCAGGGTCACATGG + Intronic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926353387 2:12017690-12017712 GTGACTTCCATAAGGTGACAAGG + Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
927364914 2:22283520-22283542 GCCATTTCCTCAAGGCCACACGG - Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932721331 2:74140870-74140892 AAAACTTGCTCAAGGTCACATGG + Intronic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934098381 2:88627927-88627949 TCGACCTCCTCCCGGTCACAAGG - Intergenic
935639604 2:105278533-105278555 CCTACTTGCTCAAGGTCACGCGG - Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
936589783 2:113792646-113792668 ATGTCTTCCTCCAGGTCACATGG - Intergenic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
936913790 2:117618665-117618687 GTGACTGGCTTAAGGTCACATGG - Intergenic
937034588 2:118770207-118770229 GCAACTTGCCCAAGGTCGCATGG - Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939035380 2:137124541-137124563 GCTACTTCCTCAAGCACACAGGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG + Intergenic
941642142 2:167999899-167999921 GCTGCTTCCAGAAGGTCACAGGG - Intronic
942605659 2:177687862-177687884 GTGACTTGTTCAAGGTCCCAGGG + Intronic
943537038 2:189165652-189165674 GGAACTTGTTCAAGGTCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
944035577 2:195290763-195290785 CCCACTACCACAAGGTCACAAGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945622492 2:212158179-212158201 GCAACTTGCCCAAAGTCACATGG + Intronic
945975798 2:216269769-216269791 GCCAGTTCCTCAAGGTCACAAGG + Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946576407 2:221080706-221080728 GAAATTTCCTCAAGGTCATAGGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947354862 2:229281470-229281492 GTGACTTTCTCAAAGTCACCTGG - Intergenic
948697446 2:239739310-239739332 GCCACTTCCTGAAGGTCAGAAGG + Intergenic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169250839 20:4060212-4060234 GTCACTTGCTCAAGGCCACATGG - Intergenic
1170427004 20:16245150-16245172 ATGACTTGCTGAAGGTCACAAGG + Intergenic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172230710 20:33333864-33333886 CCGGCTTCTTCAAGGTCCCAAGG - Intergenic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1172801180 20:37577297-37577319 GTGACTTGCGCAGGGTCACAAGG - Intergenic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172852017 20:37973230-37973252 GAGACTTTCCCAAGGCCACATGG + Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173525367 20:43728366-43728388 ACACCTTCCCCAAGGTCACATGG - Intergenic
1173655555 20:44698194-44698216 GTAACTTCCCCAAGGCCACATGG + Intergenic
1173708065 20:45128337-45128359 ATGAATTCCACAAGGTCACATGG - Intergenic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174415941 20:50367140-50367162 ACGACTTTTCCAAGGTCACAAGG - Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1175909621 20:62398567-62398589 GCGCCGTCCTCAGGGTCCCATGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1181032168 22:20153887-20153909 CCGGCTTCCTCAAGTTAACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181489798 22:23254482-23254504 GTGGCTTCCCCAAGGTCTCATGG + Intronic
1181601127 22:23952430-23952452 GGGACTTGCACAAGGCCACAGGG + Intergenic
1181837478 22:25622731-25622753 GCGACTTCCTAAATGCGACAGGG - Intronic
1181915469 22:26276308-26276330 GGAATTTGCTCAAGGTCACATGG + Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182038449 22:27217545-27217567 AAGACTTGCCCAAGGTCACACGG - Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182414540 22:30212779-30212801 GTGACTTCCTCTGGGTCACACGG + Intergenic
1182554548 22:31122270-31122292 GGAACTTGCTCAAGGTCACCTGG - Intergenic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183670706 22:39270736-39270758 GCCCCTTGCTCAGGGTCACAAGG - Intergenic
1183713213 22:39519088-39519110 GCTTCTTGCTCAAAGTCACAAGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949859922 3:8495709-8495731 GCTACTTCTTCAAGGTCAGCAGG + Intergenic
949919031 3:8987052-8987074 GAGATTTGCTCAGGGTCACACGG - Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950225956 3:11234694-11234716 GCCACTTCTGCAAGGTCTCAGGG - Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950440768 3:13008960-13008982 GTGACTTGCACAAGGCCACATGG + Intronic
950473495 3:13201167-13201189 TCGGCTCCCTCAAGGCCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
950585632 3:13890410-13890432 GTCACTTGCACAAGGTCACAGGG - Intergenic
950660525 3:14464155-14464177 GCGGCTTCCTGGAGGTCTCATGG + Intronic
950661030 3:14467128-14467150 TCCACCTCCCCAAGGTCACAAGG - Intronic
950897908 3:16469974-16469996 GTGACTTGCTCAAGGTCATGGGG + Intronic
951095860 3:18630095-18630117 GTTACATCCTCAAGGTCATATGG + Intergenic
951586002 3:24215344-24215366 GCAACTTGCTCCAAGTCACAAGG + Intronic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
954589681 3:51771990-51772012 GCCACTTTCTCAGGGACACATGG + Intergenic
954790397 3:53128910-53128932 GTGATTTCCTCACTGTCACACGG + Intronic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955412438 3:58664640-58664662 GCAACTTGCCTAAGGTCACATGG + Intronic
955705981 3:61728222-61728244 CAGACTTGCTCAAGGTCGCACGG - Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956109003 3:65852224-65852246 GTGTCTTCCACAAGGTAACAAGG + Intronic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956860416 3:73318092-73318114 GCGACTTCTGCAAGATCACAGGG - Intergenic
957347495 3:78981113-78981135 TCGACTTTCCCAAGCTCACATGG + Intronic
957780157 3:84808755-84808777 CCGACTTTTTAAAGGTCACAGGG - Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960056083 3:113277486-113277508 GCAATTTGCTCAAGGCCACACGG - Intronic
960085431 3:113585400-113585422 GCAACATCTCCAAGGTCACAAGG - Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960687407 3:120307855-120307877 GCAACTTCCTCAACGGCATACGG + Intergenic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
961661037 3:128468908-128468930 TTGACTTCCCCAAGGACACATGG - Intergenic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963713385 3:148773968-148773990 ACCACTTGCTCAAGGTCAAATGG + Intergenic
964143378 3:153429667-153429689 GGGACTTTCTTAAGGTTACACGG + Intergenic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965654259 3:170967277-170967299 ACAACTTGCTGAAGGTCACAGGG + Intergenic
965663179 3:171063929-171063951 GCTACTTCCTCCAGATCGCACGG + Exonic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
966770615 3:183500505-183500527 GTTACTTCTCCAAGGTCACATGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967526658 3:190502925-190502947 GAGAGTTGCTTAAGGTCACACGG - Intergenic
967683605 3:192394628-192394650 ATGACTTCCCCAAGGTCACCAGG + Intronic
967830557 3:193915845-193915867 TTGACTTGTTCAAGGTCACATGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968447451 4:658857-658879 GCACCTTCCTCTAGCTCACACGG + Intronic
968884523 4:3320504-3320526 GTGACTTGCTCACAGTCACAGGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969427686 4:7135303-7135325 GGGACTTGTTCAAGCTCACATGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969974513 4:11084547-11084569 GCCTCTAGCTCAAGGTCACATGG + Intergenic
970372342 4:15420677-15420699 GCAATTTGCCCAAGGTCACATGG + Intronic
970486672 4:16531614-16531636 GCAACTCCCTCAGGTTCACATGG + Intronic
970693152 4:18643086-18643108 GTGTCTCTCTCAAGGTCACATGG - Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972287219 4:37660711-37660733 TGCACTTGCTCAAGGTCACATGG + Intronic
972423701 4:38913107-38913129 GCCACCACCACAAGGTCACAGGG - Intronic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975472754 4:74789569-74789591 GCAACTTTCTCAATGTTACAAGG + Intronic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976078977 4:81333140-81333162 ATGAAGTCCTCAAGGTCACACGG - Intergenic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
977640013 4:99346893-99346915 AGGACTTGCACAAGGTCACAGGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
979324156 4:119360035-119360057 GCAACTTAGGCAAGGTCACATGG - Intergenic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
979513892 4:121584959-121584981 GAAACTTGCTCAAGGTCACTTGG - Intergenic
979533200 4:121791227-121791249 ATTACTTTCTCAAGGTCACATGG - Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981648341 4:147025956-147025978 GTGCCTTCCTTAAGGTCACATGG - Intergenic
982072160 4:151705088-151705110 GTGCCTCCTTCAAGGTCACATGG + Intronic
982293730 4:153805934-153805956 GTAACTTTCTCAAGGTCACCTGG - Intergenic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
983241993 4:165244736-165244758 GCAACTTAGGCAAGGTCACATGG - Intronic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985170476 4:187143591-187143613 GAGACTTGCTGAATGTCACATGG + Intergenic
985572652 5:657933-657955 GTGACTTCCCCTAAGTCACAGGG + Intronic
985717545 5:1471135-1471157 GTGACTTCCCAAAGTTCACAAGG + Intronic
986301933 5:6484279-6484301 GCGACTTCCTCCAGGAAACCAGG - Intronic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
987598869 5:20038981-20039003 GCAACTTCATCAAAGTCTCAGGG + Intronic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
990253023 5:53936353-53936375 ACAATTTGCTCAAGGTCACATGG + Intronic
990382346 5:55230024-55230046 GTGACTTGCTTAAGGTCACCTGG + Intergenic
990478017 5:56180788-56180810 GTGAGTTCAGCAAGGTCACAGGG - Intronic
990488120 5:56278918-56278940 GAGACCTCCTGAAGGTCACATGG - Intergenic
991189579 5:63853835-63853857 GTAACTTTCTCAGGGTCACATGG - Intergenic
992853406 5:80834937-80834959 GCCACTTCCTCAAGGTGACAGGG - Intronic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
996133931 5:119815816-119815838 GTGATTTTCACAAGGTCACATGG + Intergenic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
998364819 5:141622801-141622823 GTAACTTTCTGAAGGTCACATGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999437239 5:151572401-151572423 GAGACTTGCCCAAAGTCACAGGG + Intergenic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999699866 5:154218410-154218432 GCGACTGGTACAAGGTCACAGGG - Intronic
1000036191 5:157449926-157449948 GCAAACTGCTCAAGGTCACAAGG + Intronic
1000119171 5:158180162-158180184 GCAACTTGCCCAAGGCCACACGG - Intergenic
1000247809 5:159463441-159463463 GTGACTTGCACAAGGTCATATGG + Intergenic
1000274779 5:159724433-159724455 GCGACTTACCTAAGGTCACATGG + Intergenic
1000815230 5:165912907-165912929 GGAACTTGCTCAAGGTCAAAGGG - Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001574717 5:172755727-172755749 GCTACTCCCTCCAGGTGACATGG + Intergenic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1001837892 5:174847420-174847442 GGCACTTACTCAAGGTCACGGGG + Intergenic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1009501118 6:64415314-64415336 ACAAGTTCCACAAGGTCACATGG + Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010300051 6:74249509-74249531 GGGACTGGCTCAAGTTCACATGG - Intergenic
1011504289 6:88023943-88023965 ATGACTTGCTCAGGGTCACATGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013591126 6:111620365-111620387 GCAACTTACCCAAGGCCACAAGG + Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1015022236 6:128490627-128490649 GCGACTGCCCCAAGGTCACATGG - Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1017414392 6:154204651-154204673 ATGACTTCTTCAAGGTCACATGG - Intronic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1017587538 6:155943822-155943844 GTCACTTGCTCAAAGTCACATGG - Intergenic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018347016 6:162910227-162910249 ATAACTTCCTCAAGGTCACACGG + Intronic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1018607256 6:165610868-165610890 GCTGCTTGCTAAAGGTCACATGG - Intronic
1019296728 7:280983-281005 TCGACTTTGTCAAGGTCAGATGG - Intergenic
1019793161 7:3030539-3030561 GCGATTTGTTCAAGGTCACGAGG + Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020375884 7:7486294-7486316 GTGAGTTCAGCAAGGTCACAGGG - Intronic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1022045983 7:26622787-26622809 GCATCTTGCTCAAGGTCACTGGG - Intergenic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023132506 7:37016812-37016834 GTGACTTCTCCAAGGTCACATGG + Intronic
1026023877 7:66730270-66730292 GTGACTTCCTCAGGGTCTCAGGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026888506 7:73968526-73968548 GTGACTTCCTCAGGGTCTCCAGG - Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027219313 7:76203922-76203944 GTGACTCCCACAAGGTCACTGGG + Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032728063 7:134610516-134610538 GGCACTTCCTCAAGGGGACATGG + Intergenic
1033438268 7:141353935-141353957 GAGACTTTCTCAAGGTCAAATGG - Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038240343 8:25802342-25802364 GTGACTTGCTTAAGGTCAAATGG + Intergenic
1038774770 8:30518988-30519010 CCTTCTTCCTCAAAGTCACAAGG - Intronic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1039455798 8:37705517-37705539 GTGACTTCTTCAAAGCCACATGG - Intergenic
1040906308 8:52472816-52472838 AGAACTTGCTCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1041461857 8:58120069-58120091 ACACCTTCCTCAAGGGCACATGG + Intronic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041716047 8:60933203-60933225 GTGACCTCCTGAAGGCCACAAGG - Intergenic
1042289830 8:67158216-67158238 GCAAGTTTCTTAAGGTCACACGG + Intronic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1044391326 8:91655456-91655478 ATGACTTCCTTAAGGTCACCTGG + Intergenic
1044759710 8:95505316-95505338 GCAACTTGGCCAAGGTCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1047837786 8:128713161-128713183 GTGACTTTTTCAAGGTCACTTGG - Intergenic
1047852699 8:128876165-128876187 GTGACTGTGTCAAGGTCACAAGG + Intergenic
1047942409 8:129838168-129838190 GAGACTTGCTCAAAGTCATACGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048174612 8:132140562-132140584 GTGACTTCTCCAAGGTCACCAGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1049195814 8:141315134-141315156 CCCCCTTCCACAAGGTCACAGGG + Intergenic
1049220138 8:141425313-141425335 GTGACTTTCTTGAGGTCACACGG - Intronic
1051341918 9:16120004-16120026 AAGACTTCCCCGAGGTCACAGGG + Intergenic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052691162 9:31818515-31818537 GCAACTTGCCAAAGGTCACATGG - Intergenic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1053680589 9:40483024-40483046 GAAACTTCCTCCAGGGCACACGG + Intergenic
1053930579 9:43111335-43111357 GAAACTTCCTCCAGGGCACACGG + Intergenic
1054283123 9:63141911-63141933 GAAACTTCCTCCAGGGCACACGG - Intergenic
1054293673 9:63318539-63318561 GAAACTTCCTCCAGGGCACACGG + Intergenic
1054391695 9:64623028-64623050 GAAACTTCCTCCAGGGCACACGG + Intergenic
1054504032 9:65893300-65893322 GAAACTTCCTCCAGGGCACACGG - Exonic
1054867980 9:70022599-70022621 GCGATTTGCTCAAGGTCAGTTGG + Intergenic
1054878987 9:70125374-70125396 GAAACTTGTTCAAGGTCACAGGG + Intronic
1054892447 9:70266324-70266346 GATAATTGCTCAAGGTCACAAGG - Intronic
1054970753 9:71083360-71083382 GCAACTTGCCCAAGGTTACAAGG + Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056125424 9:83532196-83532218 GTGACTTCCCCAAAGTCACCTGG + Intronic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1057186542 9:93060280-93060302 GCGACTCACCCCAGGTCACAGGG - Intronic
1057228695 9:93305883-93305905 CAGACTTCCCCAAGGTCACTCGG - Intronic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1057746686 9:97758092-97758114 GTGACTTCTCCAACGTCACACGG + Intergenic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058683448 9:107459940-107459962 GTGAGTTCCACAAGGTCCCATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059372578 9:113854672-113854694 AGGACTTACTCAAGGTCATATGG - Intergenic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1059776759 9:117483913-117483935 GTGACTTCTCCAAAGTCACATGG + Intergenic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1059911134 9:119045538-119045560 GTGACTTTCCCAAAGTCACACGG + Intergenic
1060000898 9:119957865-119957887 GCGACTTCCTCAAACACAGATGG + Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060199745 9:121645522-121645544 GCGACTCACCCAAGGTCACATGG - Intronic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1060978089 9:127777074-127777096 GAGACTTGCTTGAGGTCACACGG - Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061211392 9:129195431-129195453 GGCACTTGCTCAGGGTCACACGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062067739 9:134537797-134537819 GCAACCTCACCAAGGTCACACGG + Intergenic
1062181088 9:135191688-135191710 GCAACTTTCTCAAGGTTGCACGG - Intergenic
1062348051 9:136124570-136124592 GCAACTTGCTCGAGGTCACTTGG + Intergenic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1186517845 X:10179890-10179912 ACAACTTGCTTAAGGTCACACGG + Intronic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187260540 X:17681623-17681645 ACGACTTGCACAATGTCACATGG + Intronic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1187444005 X:19344551-19344573 AAAACTTGCTCAAGGTCACAGGG - Intronic
1187828512 X:23357011-23357033 GTGACTTCCTCAAGGTCATCAGG + Intronic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188270489 X:28134036-28134058 GTTAATTCCTCATGGTCACAGGG - Intergenic
1188379405 X:29472696-29472718 GTGACTTCTCCAAGTTCACACGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190261570 X:48801039-48801061 GCAACTTGCCCAAAGTCACATGG + Intergenic
1190275190 X:48894812-48894834 GCCACTAGCCCAAGGTCACATGG + Intronic
1190475726 X:50825473-50825495 GTGACTTCCCCAAGGGCAAATGG - Intergenic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192306184 X:69962297-69962319 GTGACTTCTCCAAGTTCACATGG - Intronic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195671394 X:107473147-107473169 GTGACTTGCTCAGGGGCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196020670 X:110987532-110987554 GCAACTTACTCCAGGTCTCACGG - Intronic
1196699283 X:118650133-118650155 GTGACTTGCTTAGGGTCACAGGG - Intronic
1196735476 X:118977603-118977625 GGCATTTTCTCAAGGTCACACGG - Intronic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1197848418 X:130830018-130830040 GCAACTTGCCTAAGGTCACATGG + Intronic
1197888567 X:131243424-131243446 GTGACTGTTTCAAGGTCACATGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198955415 X:142123994-142124016 GCAACTTCAGCAAAGTCACAGGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1201345376 Y:12977720-12977742 ACAATCTCCTCAAGGTCACATGG + Intergenic