ID: 1049193123

View in Genome Browser
Species Human (GRCh38)
Location 8:141299888-141299910
Sequence CTGGAAAGGGGATCCTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049193123_1049193129 -8 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193129 8:141299903-141299925 CTTTCCAGGGTGATTTAATCCGG No data
1049193123_1049193137 12 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193137 8:141299923-141299945 CGGTTCTGTGGGGGTAATTAGGG No data
1049193123_1049193136 11 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193136 8:141299922-141299944 CCGGTTCTGTGGGGGTAATTAGG No data
1049193123_1049193140 30 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193140 8:141299941-141299963 TAGGGGCTGGCCTGTCTTCCTGG No data
1049193123_1049193139 17 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193139 8:141299928-141299950 CTGTGGGGGTAATTAGGGGCTGG No data
1049193123_1049193132 1 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193132 8:141299912-141299934 GTGATTTAATCCGGTTCTGTGGG No data
1049193123_1049193134 3 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193134 8:141299914-141299936 GATTTAATCCGGTTCTGTGGGGG No data
1049193123_1049193133 2 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193133 8:141299913-141299935 TGATTTAATCCGGTTCTGTGGGG No data
1049193123_1049193131 0 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193131 8:141299911-141299933 GGTGATTTAATCCGGTTCTGTGG No data
1049193123_1049193138 13 Left 1049193123 8:141299888-141299910 CCAATGGAGGATCCCCTTTCCAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1049193138 8:141299924-141299946 GGTTCTGTGGGGGTAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049193123 Original CRISPR CTGGAAAGGGGATCCTCCAT TGG (reversed) Intronic
900974617 1:6009224-6009246 CTGGAAAGCAGATACTCCAAGGG - Intronic
902155316 1:14480240-14480262 CTGCAAAGGGGACCTTCTATAGG + Intergenic
902970659 1:20045746-20045768 TTGGATAGGGGAGCCTCCACTGG - Intronic
903427728 1:23266861-23266883 CTGGAAAGGGGATCAAAAATGGG - Intergenic
909494368 1:76261922-76261944 CTGGAATGGAGAACCTCCAGTGG + Intronic
912280295 1:108305451-108305473 CTGGGCAGGGGAGGCTCCATTGG + Intergenic
912287931 1:108388906-108388928 CTGGGCAGGGGAGGCTCCATTGG - Intronic
912473024 1:109918673-109918695 CTGAAACGGGGATGATCCATGGG + Intronic
912585859 1:110764679-110764701 TGGCAAAGGGGATTCTCCATTGG + Intergenic
912982670 1:114390741-114390763 CTGGAAAGGCAATACTACATAGG - Intergenic
917477126 1:175378586-175378608 GTGGAAAGGGAAGCCTGCATTGG + Intronic
1064250864 10:13705499-13705521 GCAGAAAGGGGATGCTCCATAGG - Intronic
1065023910 10:21523766-21523788 CTGGAAAGGGAATCCTCTTCTGG + Exonic
1066438306 10:35414266-35414288 CTTGGAAGGGGATCCTCCCCAGG - Intronic
1066465000 10:35642771-35642793 CGGGAAAGGGTGTCCTCCTTGGG + Intergenic
1068362883 10:56002571-56002593 CTGGAAACAGAATCCTCCACTGG + Intergenic
1070396484 10:76015334-76015356 CTTGGAAAGGGATCCTCCCTGGG - Intronic
1078357541 11:10643400-10643422 CAGGAAAGAGGATCCACCAGAGG - Intronic
1078944570 11:16049754-16049776 CTGGGAAGAGGATCCTCTTTAGG - Exonic
1080871491 11:36240790-36240812 CTGGAATGGGGATTCTCCCTGGG - Intergenic
1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG + Intergenic
1087710315 11:101541623-101541645 ATGGTAAGGGAATTCTCCATGGG + Intronic
1088212833 11:107475384-107475406 GGGGAAAGGGGATTCTCTATAGG - Intergenic
1089606003 11:119641664-119641686 CTGGAATGGGGTTCCTCCTCTGG + Intronic
1090423858 11:126593631-126593653 CTGGAATGGGGGTCATCCATGGG + Intronic
1093642164 12:21540820-21540842 CTGGATCAGTGATCCTCCATGGG + Intronic
1094011811 12:25817595-25817617 CTAGAAAGGTGGTCCTTCATTGG + Intergenic
1096531538 12:52245648-52245670 CTGGAAAGGGGATGCTTCTAGGG + Intronic
1098841916 12:75487572-75487594 CTGGAGAGGGTACCCTCCTTTGG - Intronic
1101408700 12:104452129-104452151 CTGGGAGGTGGATGCTCCATAGG - Intergenic
1103975696 12:124701227-124701249 CTGGAAACCGGAGCCTCCTTGGG + Intergenic
1107067818 13:36234595-36234617 CTGTAAAAGGGATCTTCAATAGG + Intronic
1109801092 13:67379890-67379912 GTGGAAAGGTGATCCTCCCCTGG - Intergenic
1111122447 13:83871505-83871527 GCGGAAAAGGGATTCTCCATAGG - Intergenic
1112339155 13:98538172-98538194 AAGGAAAGGGTATTCTCCATCGG + Intronic
1113618617 13:111698229-111698251 CTGCACAGGGGATCCTGCATTGG - Intergenic
1113624146 13:111783490-111783512 CTGCACAGGGGATCCTGCATTGG - Intergenic
1124023937 15:25947467-25947489 CTGGAAAGCGGTTGCTCCAAGGG + Intergenic
1124070977 15:26393098-26393120 CTGCCAAGGGGATACTCCACAGG - Intergenic
1124322898 15:28728389-28728411 CTGGAAAGCGGTTGCTCCAAGGG - Intronic
1124523820 15:30428949-30428971 CTGGAAAGCGGTTGCTCCAAGGG - Intergenic
1124534846 15:30537266-30537288 CTGGAAAGCGGTTGCTCCAAGGG + Intergenic
1124610488 15:31204618-31204640 GTGGAAAGAGGATCCTACAGCGG - Intergenic
1124763803 15:32470341-32470363 CTGGAAAGCGGTTGCTCCAAGGG - Intergenic
1124774825 15:32578710-32578732 CTGGAAAGCGGTTGCTCCAAGGG + Intergenic
1126267741 15:46774149-46774171 AGGGAAAGGGGATTCTCTATAGG + Intergenic
1135841682 16:25882492-25882514 CTGGAAAGACAATCCACCATCGG - Intronic
1137773090 16:51033869-51033891 CAGGAAAGGGGATTCTGCCTAGG - Intergenic
1144638843 17:16926733-16926755 CTGGGATGGGGATTCTCCAAGGG - Intergenic
1144999255 17:19292025-19292047 CTGAAAAGGGAGTCCTACATGGG + Intronic
1147572893 17:41582361-41582383 CAGGAGAGGGGATCTTCCAGTGG + Exonic
1148876505 17:50690446-50690468 CTGGAGAAGTGCTCCTCCATGGG - Intronic
1149217543 17:54375358-54375380 GGGGAAAGGGGATTCTCTATAGG + Intergenic
1151342032 17:73477684-73477706 CTAGAATGGGGATCCTCTAGGGG + Intronic
1151929605 17:77223865-77223887 CCGGAAAGCGGCTCCTCCCTGGG + Intergenic
1154089385 18:11343424-11343446 AGGGAAAGGGGATTCTCTATAGG + Intergenic
1156271367 18:35536150-35536172 CTTGTTTGGGGATCCTCCATAGG - Intergenic
1156331532 18:36128691-36128713 CAGGAAAGGAGATCCTTCAACGG - Intronic
1157718658 18:49906708-49906730 CTGGCCAGGGGATTCTGCATGGG - Intronic
1160829343 19:1095746-1095768 CTGTACAGGGTTTCCTCCATTGG + Intergenic
1167785382 19:51631349-51631371 CTGAAAAGTGGATCCTGCAAGGG - Intronic
926197428 2:10772365-10772387 CTGGGCAGGGGATTCCCCATGGG + Intronic
927905019 2:26849324-26849346 CTGGGAAGGGGAGCCTCCCGAGG + Intronic
930705359 2:54499929-54499951 CTGGAAAACACATCCTCCATTGG - Intronic
935402661 2:102676300-102676322 CTAGAATGGGGACACTCCATGGG + Intronic
936342229 2:111643797-111643819 CATGAAGGGGGTTCCTCCATTGG - Intergenic
946806657 2:223477260-223477282 GTGGAACAGGGATACTCCATAGG + Intergenic
947222022 2:227802908-227802930 CTGGAAGGGTGATGTTCCATGGG + Intergenic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
1175371812 20:58497301-58497323 CTGGAAAGTGGGTTCTCCCTGGG + Intronic
1176075261 20:63245411-63245433 CTGGAAGGGGCATCTTCCAATGG - Intronic
949439956 3:4069876-4069898 GGGGAAAGGGGATTCTCTATAGG - Intronic
949465980 3:4344259-4344281 CGGGGAAGGGGAACCCCCATTGG + Intronic
950126477 3:10512998-10513020 CTGGGAAGGAGATGCTCAATGGG - Intronic
954484082 3:50830147-50830169 CTGGAAAAGGGATCCATAATTGG + Intronic
956321655 3:68004321-68004343 CTGGAGTGGGGATGGTCCATCGG + Exonic
956447519 3:69340052-69340074 CTGGAAAGGAGATCTTACAGAGG - Intronic
957736758 3:84213575-84213597 CTGGAAATGGAATTCTTCATTGG - Intergenic
964291201 3:155182742-155182764 CTGGAGAGTTGTTCCTCCATAGG - Exonic
969877771 4:10148663-10148685 CTGCAATGGGGAACCTTCATGGG + Intergenic
973253493 4:48085328-48085350 CTTGAAAGGGCATCCTCCGGTGG - Intronic
975250911 4:72176743-72176765 GGGGAAAGGGGATTCTCTATAGG - Intergenic
978760184 4:112348930-112348952 CAGGAAAGAAGAGCCTCCATCGG - Intronic
985917207 5:2931353-2931375 CTTGAAATGTGATCCTGCATTGG + Intergenic
992720811 5:79559699-79559721 GGGGAAAGGGGATTCTCTATAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995604687 5:113839857-113839879 CTGGAGAGTGGATACTCTATTGG - Intergenic
997739296 5:136239617-136239639 CTGCAAAGGGGATCCTGCTGAGG - Intronic
1000151533 5:158506081-158506103 ATGGAAAGGGGAACCCCTATTGG + Intergenic
1001961738 5:175883810-175883832 TGGGAAAGGGGATCCCCCACGGG - Exonic
1002300833 5:178256544-178256566 CAGGAACGGGGCTCCTCCAGGGG + Intronic
1024131407 7:46356243-46356265 CTGGAAGGGTGAGCCTCCCTTGG - Intergenic
1030608842 7:111667329-111667351 CTGTAAAGGTGAGCCTCCCTGGG + Intergenic
1042083731 8:65086064-65086086 CAGGGAAGGGGATACTCCAGTGG - Intergenic
1046916297 8:119681471-119681493 AAGGAAAGGGGATGCTCCTTTGG + Intergenic
1049193123 8:141299888-141299910 CTGGAAAGGGGATCCTCCATTGG - Intronic
1049300387 8:141866609-141866631 CGGGAAGGGGGATCGTCCCTGGG + Intergenic
1051889895 9:21930881-21930903 CTGGAAATGGGATCTTCCCTGGG + Intronic
1060814226 9:126626388-126626410 CCGGAAAGGGTTTCCTCCATCGG - Intronic
1062073043 9:134568648-134568670 CTGGCTAGGGGAACCTCCTTGGG - Intergenic
1188472863 X:30559844-30559866 GTAGAAATGGAATCCTCCATGGG + Exonic
1191133595 X:57040844-57040866 CTAGAAAGGCCATCCTCCAGTGG + Intergenic
1192024091 X:67429762-67429784 ATGGACAAGGGATCCTCAATAGG - Intergenic
1194480070 X:94411108-94411130 GGGGAAAGGGGATTCTCTATAGG - Intergenic
1198439826 X:136652278-136652300 TTGGAAAGGGGATCCGTCATTGG - Intronic