ID: 1049194594

View in Genome Browser
Species Human (GRCh38)
Location 8:141308384-141308406
Sequence TATGCAGCACCCGCCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049194587_1049194594 12 Left 1049194587 8:141308349-141308371 CCGCTGACGCAGCGCCGGCCCCT No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194590_1049194594 -7 Left 1049194590 8:141308368-141308390 CCCTGCGCCTCATGACTATGCAG No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194589_1049194594 -6 Left 1049194589 8:141308367-141308389 CCCCTGCGCCTCATGACTATGCA No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194583_1049194594 28 Left 1049194583 8:141308333-141308355 CCGCTCCGCGCCGCTTCCGCTGA No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194588_1049194594 -2 Left 1049194588 8:141308363-141308385 CCGGCCCCTGCGCCTCATGACTA No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194585_1049194594 18 Left 1049194585 8:141308343-141308365 CCGCTTCCGCTGACGCAGCGCCG No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194584_1049194594 23 Left 1049194584 8:141308338-141308360 CCGCGCCGCTTCCGCTGACGCAG No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data
1049194591_1049194594 -8 Left 1049194591 8:141308369-141308391 CCTGCGCCTCATGACTATGCAGC No data
Right 1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049194594 Original CRISPR TATGCAGCACCCGCCGCCGC GGG Intergenic
No off target data available for this crispr