ID: 1049195454

View in Genome Browser
Species Human (GRCh38)
Location 8:141313260-141313282
Sequence GACCACAGCCTACACAGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049195445_1049195454 23 Left 1049195445 8:141313214-141313236 CCTGCCCAGCTTCCTTAGAGAAT No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data
1049195444_1049195454 24 Left 1049195444 8:141313213-141313235 CCCTGCCCAGCTTCCTTAGAGAA No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data
1049195451_1049195454 11 Left 1049195451 8:141313226-141313248 CCTTAGAGAATGGAGGCACAGGA No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data
1049195448_1049195454 18 Left 1049195448 8:141313219-141313241 CCAGCTTCCTTAGAGAATGGAGG No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data
1049195443_1049195454 25 Left 1049195443 8:141313212-141313234 CCCCTGCCCAGCTTCCTTAGAGA No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data
1049195447_1049195454 19 Left 1049195447 8:141313218-141313240 CCCAGCTTCCTTAGAGAATGGAG No data
Right 1049195454 8:141313260-141313282 GACCACAGCCTACACAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049195454 Original CRISPR GACCACAGCCTACACAGCGG TGG Intergenic
No off target data available for this crispr