ID: 1049196965

View in Genome Browser
Species Human (GRCh38)
Location 8:141320989-141321011
Sequence TCTGAGGCCCCAAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049196960_1049196965 -8 Left 1049196960 8:141320974-141320996 CCTCCCCGGGAGAACTCTGAGGC No data
Right 1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049196965 Original CRISPR TCTGAGGCCCCAAAGCAGGA AGG Intergenic
No off target data available for this crispr