ID: 1049199306

View in Genome Browser
Species Human (GRCh38)
Location 8:141332065-141332087
Sequence CTGCTGCCGGGAAGGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049199295_1049199306 1 Left 1049199295 8:141332041-141332063 CCCCTTCACCTGCTTCCTGGTGA No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199291_1049199306 16 Left 1049199291 8:141332026-141332048 CCTCAGGGCCCATAACCCCTTCA No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199297_1049199306 -1 Left 1049199297 8:141332043-141332065 CCTTCACCTGCTTCCTGGTGACC No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199293_1049199306 7 Left 1049199293 8:141332035-141332057 CCATAACCCCTTCACCTGCTTCC No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199296_1049199306 0 Left 1049199296 8:141332042-141332064 CCCTTCACCTGCTTCCTGGTGAC No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199298_1049199306 -7 Left 1049199298 8:141332049-141332071 CCTGCTTCCTGGTGACCTGCTGC No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data
1049199292_1049199306 8 Left 1049199292 8:141332034-141332056 CCCATAACCCCTTCACCTGCTTC No data
Right 1049199306 8:141332065-141332087 CTGCTGCCGGGAAGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049199306 Original CRISPR CTGCTGCCGGGAAGGGCCCT GGG Intergenic
No off target data available for this crispr