ID: 1049199866

View in Genome Browser
Species Human (GRCh38)
Location 8:141334735-141334757
Sequence CCTGGTAAACAGTAGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049199861_1049199866 2 Left 1049199861 8:141334710-141334732 CCACGGGCCTGTGAGTCTTTCAG No data
Right 1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG No data
1049199856_1049199866 26 Left 1049199856 8:141334686-141334708 CCGCAGCCTGGGAGAGAGGGGAA No data
Right 1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG No data
1049199857_1049199866 20 Left 1049199857 8:141334692-141334714 CCTGGGAGAGAGGGGAACCCACG No data
Right 1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG No data
1049199862_1049199866 -5 Left 1049199862 8:141334717-141334739 CCTGTGAGTCTTTCAGATCCTGG No data
Right 1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG No data
1049199860_1049199866 3 Left 1049199860 8:141334709-141334731 CCCACGGGCCTGTGAGTCTTTCA No data
Right 1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049199866 Original CRISPR CCTGGTAAACAGTAGGAGCA CGG Intergenic
No off target data available for this crispr