ID: 1049200781

View in Genome Browser
Species Human (GRCh38)
Location 8:141339612-141339634
Sequence CAGGCTCAAGGCCTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049200781_1049200794 13 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200794 8:141339648-141339670 TGCTGCCCCAGGGCAGGTGGTGG No data
1049200781_1049200791 7 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200791 8:141339642-141339664 AGCTCCTGCTGCCCCAGGGCAGG No data
1049200781_1049200789 2 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200789 8:141339637-141339659 TTTGCAGCTCCTGCTGCCCCAGG No data
1049200781_1049200790 3 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200790 8:141339638-141339660 TTGCAGCTCCTGCTGCCCCAGGG No data
1049200781_1049200795 16 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200795 8:141339651-141339673 TGCCCCAGGGCAGGTGGTGGTGG No data
1049200781_1049200792 10 Left 1049200781 8:141339612-141339634 CCTTCCCCCAGGCCTTGAGCCTG No data
Right 1049200792 8:141339645-141339667 TCCTGCTGCCCCAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049200781 Original CRISPR CAGGCTCAAGGCCTGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr