ID: 1049202256

View in Genome Browser
Species Human (GRCh38)
Location 8:141346078-141346100
Sequence CTCCCTTGCCACCGGCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049202248_1049202256 13 Left 1049202248 8:141346042-141346064 CCAGAGACCGCCGAGTGACACAC No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data
1049202247_1049202256 21 Left 1049202247 8:141346034-141346056 CCAAGGGGCCAGAGACCGCCGAG No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data
1049202245_1049202256 27 Left 1049202245 8:141346028-141346050 CCTGACCCAAGGGGCCAGAGACC No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data
1049202246_1049202256 22 Left 1049202246 8:141346033-141346055 CCCAAGGGGCCAGAGACCGCCGA No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data
1049202250_1049202256 3 Left 1049202250 8:141346052-141346074 CCGAGTGACACACACCCAAGCAC No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data
1049202249_1049202256 6 Left 1049202249 8:141346049-141346071 CCGCCGAGTGACACACACCCAAG No data
Right 1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049202256 Original CRISPR CTCCCTTGCCACCGGCTTTG GGG Intergenic