ID: 1049203316

View in Genome Browser
Species Human (GRCh38)
Location 8:141352126-141352148
Sequence AGCTGTGGGCCAGGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203316_1049203333 4 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203333 8:141352153-141352175 GGTGGGGGGTCAGGATGTAGGGG No data
1049203316_1049203335 8 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203316_1049203332 3 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203332 8:141352152-141352174 TGGTGGGGGGTCAGGATGTAGGG No data
1049203316_1049203327 -10 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203327 8:141352139-141352161 GCCCACAGCTTTCTGGTGGGGGG No data
1049203316_1049203334 5 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG No data
1049203316_1049203337 27 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203337 8:141352176-141352198 GTGGCCTTGACCCTGGAGTCAGG No data
1049203316_1049203331 2 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203331 8:141352151-141352173 CTGGTGGGGGGTCAGGATGTAGG No data
1049203316_1049203330 -5 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203316_1049203336 20 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203336 8:141352169-141352191 GTAGGGGGTGGCCTTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203316 Original CRISPR AGCTGTGGGCCAGGGAGAGG GGG (reversed) Intergenic