ID: 1049203317

View in Genome Browser
Species Human (GRCh38)
Location 8:141352127-141352149
Sequence AAGCTGTGGGCCAGGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203317_1049203335 7 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203317_1049203339 30 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203339 8:141352180-141352202 CCTTGACCCTGGAGTCAGGCAGG No data
1049203317_1049203330 -6 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203317_1049203331 1 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203331 8:141352151-141352173 CTGGTGGGGGGTCAGGATGTAGG No data
1049203317_1049203334 4 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG No data
1049203317_1049203336 19 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203336 8:141352169-141352191 GTAGGGGGTGGCCTTGACCCTGG No data
1049203317_1049203332 2 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203332 8:141352152-141352174 TGGTGGGGGGTCAGGATGTAGGG No data
1049203317_1049203333 3 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203333 8:141352153-141352175 GGTGGGGGGTCAGGATGTAGGGG No data
1049203317_1049203337 26 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203337 8:141352176-141352198 GTGGCCTTGACCCTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203317 Original CRISPR AAGCTGTGGGCCAGGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr