ID: 1049203321

View in Genome Browser
Species Human (GRCh38)
Location 8:141352134-141352156
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203321_1049203335 0 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203321_1049203339 23 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203339 8:141352180-141352202 CCTTGACCCTGGAGTCAGGCAGG No data
1049203321_1049203343 29 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203321_1049203333 -4 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203333 8:141352153-141352175 GGTGGGGGGTCAGGATGTAGGGG No data
1049203321_1049203337 19 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203337 8:141352176-141352198 GTGGCCTTGACCCTGGAGTCAGG No data
1049203321_1049203341 28 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203341 8:141352185-141352207 ACCCTGGAGTCAGGCAGGGCTGG No data
1049203321_1049203331 -6 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203331 8:141352151-141352173 CTGGTGGGGGGTCAGGATGTAGG No data
1049203321_1049203336 12 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203336 8:141352169-141352191 GTAGGGGGTGGCCTTGACCCTGG No data
1049203321_1049203334 -3 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG No data
1049203321_1049203332 -5 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203332 8:141352152-141352174 TGGTGGGGGGTCAGGATGTAGGG No data
1049203321_1049203340 24 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203340 8:141352181-141352203 CTTGACCCTGGAGTCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203321 Original CRISPR CACCAGAAAGCTGTGGGCCA GGG (reversed) Intergenic