ID: 1049203322

View in Genome Browser
Species Human (GRCh38)
Location 8:141352135-141352157
Sequence CCACCAGAAAGCTGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203322_1049203334 -4 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG No data
1049203322_1049203341 27 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203341 8:141352185-141352207 ACCCTGGAGTCAGGCAGGGCTGG No data
1049203322_1049203335 -1 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203322_1049203343 28 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203322_1049203337 18 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203337 8:141352176-141352198 GTGGCCTTGACCCTGGAGTCAGG No data
1049203322_1049203331 -7 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203331 8:141352151-141352173 CTGGTGGGGGGTCAGGATGTAGG No data
1049203322_1049203340 23 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203340 8:141352181-141352203 CTTGACCCTGGAGTCAGGCAGGG No data
1049203322_1049203336 11 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203336 8:141352169-141352191 GTAGGGGGTGGCCTTGACCCTGG No data
1049203322_1049203339 22 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203339 8:141352180-141352202 CCTTGACCCTGGAGTCAGGCAGG No data
1049203322_1049203333 -5 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203333 8:141352153-141352175 GGTGGGGGGTCAGGATGTAGGGG No data
1049203322_1049203332 -6 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203332 8:141352152-141352174 TGGTGGGGGGTCAGGATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203322 Original CRISPR CCACCAGAAAGCTGTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr