ID: 1049203327

View in Genome Browser
Species Human (GRCh38)
Location 8:141352139-141352161
Sequence GCCCACAGCTTTCTGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203316_1049203327 -10 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203327 8:141352139-141352161 GCCCACAGCTTTCTGGTGGGGGG No data
1049203314_1049203327 23 Left 1049203314 8:141352093-141352115 CCAGAGACGTTCTGCAGACGCTG No data
Right 1049203327 8:141352139-141352161 GCCCACAGCTTTCTGGTGGGGGG No data
1049203313_1049203327 29 Left 1049203313 8:141352087-141352109 CCACAGCCAGAGACGTTCTGCAG No data
Right 1049203327 8:141352139-141352161 GCCCACAGCTTTCTGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203327 Original CRISPR GCCCACAGCTTTCTGGTGGG GGG Intergenic