ID: 1049203329

View in Genome Browser
Species Human (GRCh38)
Location 8:141352141-141352163
Sequence GACCCCCCACCAGAAAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203329_1049203343 22 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203329_1049203341 21 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203341 8:141352185-141352207 ACCCTGGAGTCAGGCAGGGCTGG No data
1049203329_1049203345 25 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203345 8:141352189-141352211 TGGAGTCAGGCAGGGCTGGGAGG No data
1049203329_1049203339 16 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203339 8:141352180-141352202 CCTTGACCCTGGAGTCAGGCAGG No data
1049203329_1049203337 12 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203337 8:141352176-141352198 GTGGCCTTGACCCTGGAGTCAGG No data
1049203329_1049203336 5 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203336 8:141352169-141352191 GTAGGGGGTGGCCTTGACCCTGG No data
1049203329_1049203347 27 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203347 8:141352191-141352213 GAGTCAGGCAGGGCTGGGAGGGG No data
1049203329_1049203335 -7 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203329_1049203334 -10 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG No data
1049203329_1049203346 26 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203346 8:141352190-141352212 GGAGTCAGGCAGGGCTGGGAGGG No data
1049203329_1049203340 17 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203340 8:141352181-141352203 CTTGACCCTGGAGTCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203329 Original CRISPR GACCCCCCACCAGAAAGCTG TGG (reversed) Intergenic
No off target data available for this crispr