ID: 1049203330

View in Genome Browser
Species Human (GRCh38)
Location 8:141352144-141352166
Sequence CAGCTTTCTGGTGGGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203319_1049203330 -8 Left 1049203319 8:141352129-141352151 CCTCTCCCTGGCCCACAGCTTTC No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203318_1049203330 -7 Left 1049203318 8:141352128-141352150 CCCTCTCCCTGGCCCACAGCTTT No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203316_1049203330 -5 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203317_1049203330 -6 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data
1049203314_1049203330 28 Left 1049203314 8:141352093-141352115 CCAGAGACGTTCTGCAGACGCTG No data
Right 1049203330 8:141352144-141352166 CAGCTTTCTGGTGGGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203330 Original CRISPR CAGCTTTCTGGTGGGGGGTC AGG Intergenic