ID: 1049203335

View in Genome Browser
Species Human (GRCh38)
Location 8:141352157-141352179
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203322_1049203335 -1 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203316_1049203335 8 Left 1049203316 8:141352126-141352148 CCCCCTCTCCCTGGCCCACAGCT No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203319_1049203335 5 Left 1049203319 8:141352129-141352151 CCTCTCCCTGGCCCACAGCTTTC No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203329_1049203335 -7 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203321_1049203335 0 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203318_1049203335 6 Left 1049203318 8:141352128-141352150 CCCTCTCCCTGGCCCACAGCTTT No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203328_1049203335 -6 Left 1049203328 8:141352140-141352162 CCCACAGCTTTCTGGTGGGGGGT 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data
1049203317_1049203335 7 Left 1049203317 8:141352127-141352149 CCCCTCTCCCTGGCCCACAGCTT No data
Right 1049203335 8:141352157-141352179 GGGGGTCAGGATGTAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203335 Original CRISPR GGGGGTCAGGATGTAGGGGG TGG Intergenic