ID: 1049203343

View in Genome Browser
Species Human (GRCh38)
Location 8:141352186-141352208
Sequence CCCTGGAGTCAGGCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203329_1049203343 22 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203328_1049203343 23 Left 1049203328 8:141352140-141352162 CCCACAGCTTTCTGGTGGGGGGT No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203322_1049203343 28 Left 1049203322 8:141352135-141352157 CCTGGCCCACAGCTTTCTGGTGG No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data
1049203321_1049203343 29 Left 1049203321 8:141352134-141352156 CCCTGGCCCACAGCTTTCTGGTG No data
Right 1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203343 Original CRISPR CCCTGGAGTCAGGCAGGGCT GGG Intergenic