ID: 1049203346

View in Genome Browser
Species Human (GRCh38)
Location 8:141352190-141352212
Sequence GGAGTCAGGCAGGGCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203328_1049203346 27 Left 1049203328 8:141352140-141352162 CCCACAGCTTTCTGGTGGGGGGT No data
Right 1049203346 8:141352190-141352212 GGAGTCAGGCAGGGCTGGGAGGG No data
1049203329_1049203346 26 Left 1049203329 8:141352141-141352163 CCACAGCTTTCTGGTGGGGGGTC No data
Right 1049203346 8:141352190-141352212 GGAGTCAGGCAGGGCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203346 Original CRISPR GGAGTCAGGCAGGGCTGGGA GGG Intergenic