ID: 1049203585

View in Genome Browser
Species Human (GRCh38)
Location 8:141353178-141353200
Sequence TCTGATGGGCAGGGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049203585_1049203600 19 Left 1049203585 8:141353178-141353200 CCCTCCATCCCCTGCCCATCAGA No data
Right 1049203600 8:141353220-141353242 CCCTAAATCTGCCTCCCAGCAGG No data
1049203585_1049203602 20 Left 1049203585 8:141353178-141353200 CCCTCCATCCCCTGCCCATCAGA No data
Right 1049203602 8:141353221-141353243 CCTAAATCTGCCTCCCAGCAGGG No data
1049203585_1049203597 -5 Left 1049203585 8:141353178-141353200 CCCTCCATCCCCTGCCCATCAGA No data
Right 1049203597 8:141353196-141353218 TCAGAGCTGGGCAGGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049203585 Original CRISPR TCTGATGGGCAGGGGATGGA GGG (reversed) Intergenic
No off target data available for this crispr