ID: 1049204814

View in Genome Browser
Species Human (GRCh38)
Location 8:141358808-141358830
Sequence AGACAGAGGCCCCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049204807_1049204814 -4 Left 1049204807 8:141358789-141358811 CCCCAAACTACAGAAAAGGAGAC 0: 1
1: 0
2: 2
3: 30
4: 457
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204800_1049204814 23 Left 1049204800 8:141358762-141358784 CCTGAGAGGCGGGCACCCCTATG 0: 1
1: 0
2: 1
3: 3
4: 75
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204809_1049204814 -6 Left 1049204809 8:141358791-141358813 CCAAACTACAGAAAAGGAGACAG 0: 1
1: 0
2: 3
3: 50
4: 541
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204801_1049204814 8 Left 1049204801 8:141358777-141358799 CCCCTATGATCCCCCCAAACTAC 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204808_1049204814 -5 Left 1049204808 8:141358790-141358812 CCCAAACTACAGAAAAGGAGACA 0: 1
1: 0
2: 4
3: 40
4: 534
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204799_1049204814 24 Left 1049204799 8:141358761-141358783 CCCTGAGAGGCGGGCACCCCTAT 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204806_1049204814 -3 Left 1049204806 8:141358788-141358810 CCCCCAAACTACAGAAAAGGAGA 0: 1
1: 0
2: 3
3: 41
4: 473
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204805_1049204814 -2 Left 1049204805 8:141358787-141358809 CCCCCCAAACTACAGAAAAGGAG 0: 1
1: 0
2: 1
3: 15
4: 273
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204803_1049204814 6 Left 1049204803 8:141358779-141358801 CCTATGATCCCCCCAAACTACAG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data
1049204802_1049204814 7 Left 1049204802 8:141358778-141358800 CCCTATGATCCCCCCAAACTACA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049204814 Original CRISPR AGACAGAGGCCCCTGTGGGG TGG Intronic
No off target data available for this crispr