ID: 1049205392

View in Genome Browser
Species Human (GRCh38)
Location 8:141361231-141361253
Sequence CCAAGGAAGTACCTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049205392_1049205403 14 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205403 8:141361268-141361290 GAACGAGGGCCTGCTCTCCAGGG No data
1049205392_1049205401 0 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205401 8:141361254-141361276 GGACAGAACAGAGGGAACGAGGG No data
1049205392_1049205398 -8 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205398 8:141361246-141361268 TTCCTTGGGGACAGAACAGAGGG No data
1049205392_1049205400 -1 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205400 8:141361253-141361275 GGGACAGAACAGAGGGAACGAGG No data
1049205392_1049205402 13 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205402 8:141361267-141361289 GGAACGAGGGCCTGCTCTCCAGG No data
1049205392_1049205397 -9 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1049205397 8:141361245-141361267 CTTCCTTGGGGACAGAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049205392 Original CRISPR CCAAGGAAGTACCTGTGTGT GGG (reversed) Intronic
901844261 1:11972025-11972047 CCAAGGAAGGAACTGAGTCTTGG - Intronic
902777319 1:18682999-18683021 ACAGGGGAGTACCTGTGTGGGGG + Intronic
904027510 1:27513882-27513904 CCAAGTGATTATCTGTGTGTGGG + Intergenic
904029149 1:27523215-27523237 CAAAGGAAGTAGCTGAGTCTCGG + Intergenic
905027768 1:34862942-34862964 CCATGGAAGCACATGTGTGTTGG - Intergenic
905350662 1:37344213-37344235 ACAAGAAAGTCCCTGTGTGCAGG + Intergenic
906114615 1:43348555-43348577 CCGAGGGTGTACCTGGGTGTTGG + Intronic
912691643 1:111809176-111809198 CCAGGGAAGTAGCTTTGTGCAGG + Intronic
916088883 1:161291602-161291624 CCAGGGAAGAACCAGTGAGTAGG + Intergenic
916675850 1:167063817-167063839 ACAAGGCAGTATATGTGTGTGGG - Intronic
919160172 1:193819433-193819455 ATAAGGAAGTATCTGTTTGTTGG + Intergenic
920629112 1:207634491-207634513 CCAAAGACATAGCTGTGTGTTGG + Intronic
920639442 1:207737693-207737715 CCAAAGACATAGCTGTGTGTTGG + Intronic
922207690 1:223462500-223462522 CCAAGTAAATACCTGTTTGTTGG - Intergenic
922538564 1:226401879-226401901 ACAAGGAAGAGCCTGTGTGGTGG + Intronic
923734656 1:236593424-236593446 TCAAGAGAGTGCCTGTGTGTTGG - Intronic
923863031 1:237911442-237911464 AGAAGGAAAAACCTGTGTGTTGG - Intergenic
1066708982 10:38212696-38212718 CTAAGCAAATATCTGTGTGTGGG - Intergenic
1068848077 10:61703768-61703790 CCTAGGAATCAACTGTGTGTAGG - Intronic
1070348470 10:75568610-75568632 GCAAGTAAGAACCTGTGTATAGG + Intronic
1070557171 10:77537485-77537507 CCAAGGAAGCTCATGTGTCTTGG - Intronic
1071979512 10:90989092-90989114 CCAAGGAAAGACCTGTGTGAAGG - Intergenic
1072244758 10:93533590-93533612 CCAAGGAATCACCAGTTTGTGGG - Intergenic
1072802248 10:98400341-98400363 CCATTTAGGTACCTGTGTGTAGG + Intronic
1073445703 10:103579082-103579104 CCAAGGCAGGACCTGGGCGTGGG - Intronic
1073458624 10:103652747-103652769 CAAAGGCAGTGTCTGTGTGTTGG + Intronic
1074873694 10:117597436-117597458 CCAAGGAAGGAGCTTTGTGTAGG + Intergenic
1076587007 10:131556186-131556208 GCAGGAAAGTCCCTGTGTGTGGG + Intergenic
1078066661 11:8083223-8083245 CTGTGGAAGTACCTGTGTGCGGG + Intronic
1081015302 11:37870787-37870809 CCAAGGAAGTACTTTTCTGTGGG - Intergenic
1084225740 11:67713766-67713788 CTAAGGAAGTACCTGTCATTGGG + Intergenic
1084263560 11:67993623-67993645 CTAAGGAAGTACCTGTCATTGGG + Intronic
1084432809 11:69121087-69121109 CCAGGCAGGTACGTGTGTGTGGG - Intergenic
1084432815 11:69121143-69121165 CCAGGCAGGTACGTGTGTGTGGG - Intergenic
1085363661 11:75916827-75916849 CCAAGTTAGTTCCTGTGTGGGGG + Intronic
1085645848 11:78222086-78222108 CCAAGTAAGTGCGTATGTGTGGG - Exonic
1087583228 11:100085538-100085560 CCAAGGAGGCACCTGTCTGGTGG + Intronic
1089391208 11:118103157-118103179 CCGAGGAAGCAGCTGTGTGACGG + Exonic
1089771809 11:120808585-120808607 CCAAGGAAGAAAGTGTGTGAGGG - Intronic
1091354333 11:134924041-134924063 CCAAGGAAGTACCAGGCTTTGGG + Intergenic
1092075682 12:5671474-5671496 CAAAGGAAGGAACTGTGTGGGGG + Intronic
1094664601 12:32506615-32506637 GCAAGGAGGTGCCTGTGGGTTGG - Intronic
1095626586 12:44321594-44321616 TCAAGGAAGCACCTCTGGGTGGG - Intronic
1103698748 12:122836333-122836355 CCCAGGAAGTTTCTGTCTGTCGG - Intronic
1104338662 12:127926265-127926287 TCAAGACAGTACCTCTGTGTTGG + Intergenic
1104360384 12:128127564-128127586 CCAGGGAAGGACCTGGGTGAAGG + Intergenic
1110179420 13:72597564-72597586 CCAGGAAAGTAACTGTGTATGGG + Intergenic
1112394087 13:99012644-99012666 CCAAGGAAGTACCAATGGGCAGG + Intronic
1113555086 13:111226985-111227007 GGAAGGAACTACCTGTGTGGTGG + Intronic
1119182782 14:72615611-72615633 CCAGGGAAGAGCCTGTGGGTGGG - Intergenic
1121121888 14:91381147-91381169 CCAGAGAAGCACCTGTGGGTGGG + Intronic
1121352126 14:93182086-93182108 CCAAGGAACTAAGTCTGTGTAGG + Intergenic
1122273539 14:100579444-100579466 CCTAGGAAGGATCTCTGTGTGGG - Intronic
1122696537 14:103555993-103556015 CCTAGGAAGTATGTGTGTGATGG - Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1127322661 15:57862987-57863009 ACATGGCAGCACCTGTGTGTGGG - Intergenic
1127698914 15:61478141-61478163 TGAAGGACGTACCTGTGTCTGGG + Intergenic
1127922956 15:63507689-63507711 CCATGGAAGGCACTGTGTGTTGG + Intronic
1128649148 15:69397857-69397879 CCAAGGCAGCACCTGGGTGTGGG - Intronic
1129636702 15:77326186-77326208 CCAAAGATGAATCTGTGTGTTGG - Intronic
1131822850 15:96290793-96290815 ACAAGAAAATATCTGTGTGTTGG - Intergenic
1131955137 15:97727513-97727535 CCAAGGATGTGACTTTGTGTAGG + Intergenic
1132360552 15:101209751-101209773 CTAAGAAAATACCTGTCTGTTGG - Intronic
1134891485 16:17845265-17845287 CCAAGGAACTGCCTGTGTGCTGG + Intergenic
1134891615 16:17846206-17846228 CCAAGGAACTGCCTGTGTGCTGG + Intergenic
1138022719 16:53499200-53499222 CCAAGGAAGTACCTATGAGATGG - Intronic
1138714683 16:59007469-59007491 CCAGGGAAATAACTGTGTGATGG - Intergenic
1140247975 16:73268544-73268566 ACAAGCAAGTCCCAGTGTGTGGG - Intergenic
1140623527 16:76764827-76764849 ACAAAGAAGTACCTGAGTCTGGG - Intergenic
1141377989 16:83549225-83549247 CCACGGGAGCACCTGTGAGTTGG + Intronic
1141612123 16:85187729-85187751 CCAAGCCTGTCCCTGTGTGTGGG - Intergenic
1141960007 16:87399374-87399396 ACAAGGAAATATCAGTGTGTAGG - Intronic
1147647654 17:42043438-42043460 CAAGGGAGGTGCCTGTGTGTGGG - Intronic
1148324184 17:46773656-46773678 CCAAGGCAGTACCTTTGTCGAGG + Exonic
1149017093 17:51920569-51920591 CCAAGGAAACACCTGGTTGTTGG - Intronic
1149361926 17:55904147-55904169 CCCAGAATTTACCTGTGTGTGGG - Intergenic
1152899312 17:82930920-82930942 ACAAGGTGGTCCCTGTGTGTAGG + Intronic
1153002307 18:466539-466561 CCCTGAAAGTGCCTGTGTGTGGG - Intronic
1157692937 18:49698591-49698613 CCGAGGAAGGGCCTGAGTGTGGG + Intergenic
1159807398 18:72972927-72972949 CTAGGGAAGTATCTGTCTGTAGG - Intergenic
1160976382 19:1794723-1794745 CCAAGGCAGCACCTGAGAGTGGG + Intronic
1163647897 19:18500574-18500596 TCAAGGAAGCAGCTGTGTGTTGG + Intronic
1165436367 19:35797530-35797552 CTAGGGAAGTGTCTGTGTGTTGG + Intergenic
1165464734 19:35967074-35967096 CCAAGACAGTATCTGTGTCTGGG + Intergenic
1168031106 19:53680535-53680557 CAAAGCAAGCACTTGTGTGTAGG + Intergenic
925692850 2:6542437-6542459 AGAGGGAATTACCTGTGTGTGGG - Intergenic
927211387 2:20641077-20641099 CCCAGGAAGGTCCTGTTTGTTGG - Exonic
931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG + Exonic
932513901 2:72325365-72325387 CCAAGGAAGGAGCCTTGTGTAGG - Intronic
940834501 2:158505837-158505859 CCCTGGAAGTACCGGTGTGGAGG + Intronic
941630834 2:167882687-167882709 CCAAGAAAGCAAGTGTGTGTGGG + Intergenic
942496785 2:176548328-176548350 CCATGGAAGTCCCTGGTTGTGGG - Intergenic
944043500 2:195382401-195382423 GCAAGGAAGTACCTCTGAGCAGG + Intergenic
944405818 2:199382220-199382242 ACAAGAAAATTCCTGTGTGTGGG + Intronic
947903426 2:233741938-233741960 ACAAGAAAGTACCTTTCTGTTGG - Intronic
1169743239 20:8917829-8917851 CCAGGGAAGTTCCTGTCTCTGGG - Intronic
1173375386 20:42478039-42478061 CAAAGGAAGAAACTGAGTGTAGG - Intronic
1179639670 21:42739038-42739060 CCTAGGACATGCCTGTGTGTGGG - Intronic
1181895702 22:26105607-26105629 CCAAAGTGGAACCTGTGTGTAGG + Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
953195232 3:40726066-40726088 CCTAGGAAGTACCTGGTTATGGG + Intergenic
956488756 3:69749250-69749272 CCAATGACATATCTGTGTGTTGG - Intronic
957079001 3:75621574-75621596 CTAAGGAAGTACCTGTCATTGGG + Intergenic
957132551 3:76241161-76241183 ACTAGGAAATACCTGTGAGTGGG - Intronic
962973806 3:140428836-140428858 CTAATGAAGGACCTGTTTGTGGG - Intronic
963586213 3:147192442-147192464 CCAAGGAAGAAACTGTTAGTTGG + Intergenic
969022078 4:4145530-4145552 CTAAGGAAGTACCTGTCACTGGG + Intergenic
973783003 4:54307194-54307216 CCAAGGAACTAGCTGTAGGTGGG + Intergenic
974179821 4:58370311-58370333 CCAAGAAAGAACCTATGTGAAGG + Intergenic
975734799 4:77370837-77370859 CAAAGGAAGTTCCTGTTTGTAGG + Intronic
977059644 4:92241078-92241100 GCAGGGAAGTGCCTGGGTGTTGG + Intergenic
977163990 4:93672318-93672340 CCAAGGGAATAGCTGTTTGTGGG + Intronic
979885146 4:126017962-126017984 CCTAGGGAGTACCTTTGGGTAGG - Intergenic
982521875 4:156427936-156427958 CCAAGGAAGAACCAATGTTTTGG + Intergenic
984175143 4:176408193-176408215 CCAAGTAAGAACATGTGAGTTGG - Intergenic
984660822 4:182373333-182373355 TCAAGGAAGTACCTGAGGCTGGG + Intronic
986789350 5:11144811-11144833 CTAAGGAAATAGATGTGTGTAGG + Intronic
991548693 5:67812457-67812479 CCAAGGAAGAACCAAAGTGTTGG - Intergenic
991654686 5:68892419-68892441 CCAAGGAAGACCCTGAGAGTTGG - Intergenic
993230055 5:85224131-85224153 CCGATGAAGTAGCAGTGTGTAGG - Intergenic
993389226 5:87297909-87297931 CCAAGGAAGTTTCTGCTTGTGGG + Intronic
997231778 5:132250767-132250789 CCTGAGAAGTAGCTGTGTGTAGG - Intronic
1000960807 5:167598679-167598701 CCAAGAGAGTAGCTGTTTGTAGG - Intronic
1001206154 5:169765104-169765126 ACAAGGAAAAAACTGTGTGTGGG - Intronic
1001956328 5:175850496-175850518 CCGAGGAAGTGCAGGTGTGTTGG - Intronic
1001961884 5:175884495-175884517 CCTGGGAAGTGCCTGTGTCTGGG - Intergenic
1001998206 5:176179076-176179098 CCAAGGAACAACTTGGGTGTTGG - Intergenic
1003003593 6:2360214-2360236 CCAAGGCAGGGCCTGTGTGTCGG + Intergenic
1005221719 6:23595250-23595272 GCACTCAAGTACCTGTGTGTGGG + Intergenic
1014793434 6:125701258-125701280 ACAAGGAAATGCCTTTGTGTGGG - Intergenic
1017936851 6:159013269-159013291 CCAATCAAATACCTGTGTGTGGG - Intergenic
1020095104 7:5363891-5363913 CGAGGGAGGGACCTGTGTGTTGG - Intronic
1020309502 7:6857571-6857593 CTAAGGAAGTACCTGTCATTGGG + Intergenic
1022205450 7:28159235-28159257 CCAGGGAAGTAACTGGGAGTGGG + Intronic
1024461257 7:49661836-49661858 CCAAAGAAGAAACTGTGGGTGGG + Intergenic
1026169161 7:67937956-67937978 CCAAGGATGTGTCTGTGTGTTGG + Intergenic
1026535211 7:71233395-71233417 CCAAGACAGTACCTCTGTGAGGG + Intronic
1030581422 7:111360384-111360406 CCAAGTACATACCTGTGTGAGGG + Intronic
1031673145 7:124576658-124576680 CACAGGAGGTACCTGTCTGTGGG - Intergenic
1034230806 7:149526994-149527016 GCAAGGAAGTACCACAGTGTTGG - Intergenic
1036441861 8:8788883-8788905 GTAAGGGAGTATCTGTGTGTTGG + Intronic
1046200483 8:110921322-110921344 CCATGGAAATACCTTTGTTTTGG - Intergenic
1047297806 8:123586880-123586902 CCAAGGAGGTACCTGTGGGAAGG + Intergenic
1047572216 8:126111355-126111377 CCAAGGAAGTGGGTGTGGGTTGG - Intergenic
1048969529 8:139637253-139637275 CCAAGGAAGCCTATGTGTGTTGG - Intronic
1049205392 8:141361231-141361253 CCAAGGAAGTACCTGTGTGTGGG - Intronic
1050829917 9:9998043-9998065 CCAAGAAAGAAACTCTGTGTGGG - Intronic
1052199526 9:25761513-25761535 CCACAGGAGTACCTGTGTCTTGG + Intergenic
1054708178 9:68484038-68484060 CCTAGCAAGTACCTGTTTCTTGG - Exonic
1055010132 9:71556158-71556180 CCATGGAAGTGCCTGTGTGTAGG - Intergenic
1056762287 9:89424148-89424170 CCAGGGAAGTAGCTGTGGGGAGG - Intronic
1058707554 9:107649952-107649974 CCCAGGAAGTAGCTTTGTGTGGG - Intergenic
1060104844 9:120867104-120867126 CCAAGGGAGGACCTGAGAGTTGG + Intronic
1189317348 X:40065378-40065400 CCAAGGGGGTCCCTTTGTGTTGG - Intronic
1189882924 X:45510778-45510800 CCAAGGGTGTGTCTGTGTGTGGG - Intergenic
1194053972 X:89107152-89107174 CAAAGCAAGTTTCTGTGTGTTGG + Intergenic
1195459471 X:105107906-105107928 CCAAGGAAGTAACTGTATCAAGG - Intronic
1199612243 X:149628391-149628413 TCAAGGAAGGACTTGTTTGTGGG + Intronic