ID: 1049205392

View in Genome Browser
Species Human (GRCh38)
Location 8:141361231-141361253
Sequence CCAAGGAAGTACCTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049205392_1049205398 -8 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205398 8:141361246-141361268 TTCCTTGGGGACAGAACAGAGGG No data
1049205392_1049205400 -1 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205400 8:141361253-141361275 GGGACAGAACAGAGGGAACGAGG No data
1049205392_1049205401 0 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205401 8:141361254-141361276 GGACAGAACAGAGGGAACGAGGG No data
1049205392_1049205397 -9 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205397 8:141361245-141361267 CTTCCTTGGGGACAGAACAGAGG No data
1049205392_1049205403 14 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205403 8:141361268-141361290 GAACGAGGGCCTGCTCTCCAGGG No data
1049205392_1049205402 13 Left 1049205392 8:141361231-141361253 CCCACACACAGGTACTTCCTTGG No data
Right 1049205402 8:141361267-141361289 GGAACGAGGGCCTGCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049205392 Original CRISPR CCAAGGAAGTACCTGTGTGT GGG (reversed) Intronic