ID: 1049206873

View in Genome Browser
Species Human (GRCh38)
Location 8:141367615-141367637
Sequence TCTCCTGGATGGTGCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049206873_1049206884 20 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206884 8:141367658-141367680 TGCTGTGTGCGGGGCAGGAGGGG No data
1049206873_1049206883 19 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206883 8:141367657-141367679 GTGCTGTGTGCGGGGCAGGAGGG No data
1049206873_1049206879 10 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206879 8:141367648-141367670 CACTTGTGTGTGCTGTGTGCGGG No data
1049206873_1049206881 15 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206881 8:141367653-141367675 GTGTGTGCTGTGTGCGGGGCAGG No data
1049206873_1049206880 11 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206880 8:141367649-141367671 ACTTGTGTGTGCTGTGTGCGGGG No data
1049206873_1049206885 21 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206885 8:141367659-141367681 GCTGTGTGCGGGGCAGGAGGGGG No data
1049206873_1049206878 9 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206878 8:141367647-141367669 GCACTTGTGTGTGCTGTGTGCGG No data
1049206873_1049206886 30 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206886 8:141367668-141367690 GGGGCAGGAGGGGGAAACTGAGG No data
1049206873_1049206882 18 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206882 8:141367656-141367678 TGTGCTGTGTGCGGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049206873 Original CRISPR TCTCCTGGATGGTGCAGCTG AGG (reversed) Intergenic