ID: 1049206876

View in Genome Browser
Species Human (GRCh38)
Location 8:141367626-141367648
Sequence GCCAGCCACTGTCTCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049206876_1049206890 29 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206890 8:141367678-141367700 GGGGAAACTGAGGCACGGAGGGG No data
1049206876_1049206884 9 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206884 8:141367658-141367680 TGCTGTGTGCGGGGCAGGAGGGG No data
1049206876_1049206878 -2 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206878 8:141367647-141367669 GCACTTGTGTGTGCTGTGTGCGG No data
1049206876_1049206882 7 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206882 8:141367656-141367678 TGTGCTGTGTGCGGGGCAGGAGG No data
1049206876_1049206879 -1 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206879 8:141367648-141367670 CACTTGTGTGTGCTGTGTGCGGG No data
1049206876_1049206887 24 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206887 8:141367673-141367695 AGGAGGGGGAAACTGAGGCACGG No data
1049206876_1049206886 19 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206886 8:141367668-141367690 GGGGCAGGAGGGGGAAACTGAGG No data
1049206876_1049206883 8 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206883 8:141367657-141367679 GTGCTGTGTGCGGGGCAGGAGGG No data
1049206876_1049206880 0 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206880 8:141367649-141367671 ACTTGTGTGTGCTGTGTGCGGGG No data
1049206876_1049206881 4 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206881 8:141367653-141367675 GTGTGTGCTGTGTGCGGGGCAGG No data
1049206876_1049206885 10 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206885 8:141367659-141367681 GCTGTGTGCGGGGCAGGAGGGGG No data
1049206876_1049206888 27 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206888 8:141367676-141367698 AGGGGGAAACTGAGGCACGGAGG No data
1049206876_1049206889 28 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206889 8:141367677-141367699 GGGGGAAACTGAGGCACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049206876 Original CRISPR GCCAGCCACTGTCTCCTGGA TGG (reversed) Intergenic