ID: 1049206879

View in Genome Browser
Species Human (GRCh38)
Location 8:141367648-141367670
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049206876_1049206879 -1 Left 1049206876 8:141367626-141367648 CCATCCAGGAGACAGTGGCTGGC No data
Right 1049206879 8:141367648-141367670 CACTTGTGTGTGCTGTGTGCGGG No data
1049206873_1049206879 10 Left 1049206873 8:141367615-141367637 CCTCAGCTGCACCATCCAGGAGA No data
Right 1049206879 8:141367648-141367670 CACTTGTGTGTGCTGTGTGCGGG No data
1049206877_1049206879 -5 Left 1049206877 8:141367630-141367652 CCAGGAGACAGTGGCTGGCACTT No data
Right 1049206879 8:141367648-141367670 CACTTGTGTGTGCTGTGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049206879 Original CRISPR CACTTGTGTGTGCTGTGTGC GGG Intergenic