ID: 1049207044

View in Genome Browser
Species Human (GRCh38)
Location 8:141368427-141368449
Sequence GAGTATCAGCAGAAGCACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049207044_1049207052 25 Left 1049207044 8:141368427-141368449 CCCGTGTGCTTCTGCTGATACTC No data
Right 1049207052 8:141368475-141368497 GTGCCGAGGCCCTGCTGAGTGGG No data
1049207044_1049207047 11 Left 1049207044 8:141368427-141368449 CCCGTGTGCTTCTGCTGATACTC No data
Right 1049207047 8:141368461-141368483 TTCCAGCCGCCTGAGTGCCGAGG No data
1049207044_1049207051 24 Left 1049207044 8:141368427-141368449 CCCGTGTGCTTCTGCTGATACTC No data
Right 1049207051 8:141368474-141368496 AGTGCCGAGGCCCTGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049207044 Original CRISPR GAGTATCAGCAGAAGCACAC GGG (reversed) Intergenic
No off target data available for this crispr