ID: 1049210653

View in Genome Browser
Species Human (GRCh38)
Location 8:141385039-141385061
Sequence CTCCATGGGGAGCCTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049210653_1049210664 8 Left 1049210653 8:141385039-141385061 CCCCCACCAGGCTCCCCATGGAG No data
Right 1049210664 8:141385070-141385092 ATGCAGGCTCAGCACACATCAGG No data
1049210653_1049210667 22 Left 1049210653 8:141385039-141385061 CCCCCACCAGGCTCCCCATGGAG No data
Right 1049210667 8:141385084-141385106 CACATCAGGCATGGAGGCCCTGG No data
1049210653_1049210665 13 Left 1049210653 8:141385039-141385061 CCCCCACCAGGCTCCCCATGGAG No data
Right 1049210665 8:141385075-141385097 GGCTCAGCACACATCAGGCATGG No data
1049210653_1049210666 16 Left 1049210653 8:141385039-141385061 CCCCCACCAGGCTCCCCATGGAG No data
Right 1049210666 8:141385078-141385100 TCAGCACACATCAGGCATGGAGG No data
1049210653_1049210663 -8 Left 1049210653 8:141385039-141385061 CCCCCACCAGGCTCCCCATGGAG No data
Right 1049210663 8:141385054-141385076 CCATGGAGGGCTCAGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049210653 Original CRISPR CTCCATGGGGAGCCTGGTGG GGG (reversed) Intergenic
No off target data available for this crispr