ID: 1049212256

View in Genome Browser
Species Human (GRCh38)
Location 8:141392172-141392194
Sequence CCCCGAAGCCGTGCCCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049212256_1049212262 -6 Left 1049212256 8:141392172-141392194 CCGCTCCGGGCACGGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1049212262 8:141392189-141392211 TCGGGGCCGCGCAGCCGGGAGGG No data
1049212256_1049212268 25 Left 1049212256 8:141392172-141392194 CCGCTCCGGGCACGGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1049212268 8:141392220-141392242 TTCCCCCTGCCCGCGCGTCCCGG No data
1049212256_1049212261 -7 Left 1049212256 8:141392172-141392194 CCGCTCCGGGCACGGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1049212261 8:141392188-141392210 TTCGGGGCCGCGCAGCCGGGAGG No data
1049212256_1049212269 26 Left 1049212256 8:141392172-141392194 CCGCTCCGGGCACGGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1049212269 8:141392221-141392243 TCCCCCTGCCCGCGCGTCCCGGG No data
1049212256_1049212260 -10 Left 1049212256 8:141392172-141392194 CCGCTCCGGGCACGGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1049212260 8:141392185-141392207 GGCTTCGGGGCCGCGCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049212256 Original CRISPR CCCCGAAGCCGTGCCCGGAG CGG (reversed) Intronic
900285573 1:1898076-1898098 CCCAGAAGCCGTGCACAGACAGG + Intergenic
902538137 1:17133500-17133522 TCCAGAAGCCATGCCCTGAGTGG - Intergenic
902856448 1:19209943-19209965 CCCCGAAGCCGTGGCTGTGGCGG + Intronic
903945580 1:26960269-26960291 CCCCGAAGCTGAGCCCGGACAGG - Intronic
905789664 1:40783528-40783550 CCCCGAAGGCCAGCCCGGGGTGG - Intergenic
906262989 1:44407245-44407267 CCCTCAAGCCGAGTCCGGAGCGG - Intronic
912928096 1:113930365-113930387 CCAGGAAGCCGTGCCTGGAGAGG + Intronic
1070741066 10:78903646-78903668 CCCCGTAGCCCTGCCTGCAGAGG + Intergenic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1076749998 10:132537758-132537780 CCGCGGAGCCGAGCCCGGGGCGG - Intergenic
1077074715 11:695110-695132 GCCCGAAGCGGGGCCCGAAGAGG + Exonic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1080033575 11:27688092-27688114 CCCAGATGCCCTGCCCAGAGAGG + Intronic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1085982782 11:81744655-81744677 CCCCCGAGCCCTGCCCGGCGGGG + Intergenic
1091545903 12:1501088-1501110 CACCACAGCCCTGCCCGGAGTGG - Intergenic
1094041808 12:26126531-26126553 CCCGGAACCCGTGCCCGGCGGGG - Intronic
1096981205 12:55728981-55729003 CCCCGGAGCCGCGGCGGGAGAGG - Intronic
1097191161 12:57220276-57220298 TCCCGAAGCCGGAGCCGGAGGGG - Intronic
1103907583 12:124335436-124335458 CCCCGAAGCCCTGCACAGTGAGG - Intronic
1113176205 13:107566844-107566866 CCCCGAGGCAGTGCCCTGAGCGG + Intronic
1113737750 13:112690301-112690323 CGCCGAGGCCGTGACCGGAGCGG + Intergenic
1114126286 14:19730034-19730056 CCACAAAGCCCTGCCCAGAGGGG - Intronic
1122858644 14:104572233-104572255 CCCCGAAGCCCTGGGCTGAGTGG + Intronic
1122892300 14:104738470-104738492 CCCAGACGCGGTGCCCTGAGCGG + Intronic
1124248871 15:28094844-28094866 TCCCGCAGCCGTGCCCAGGGCGG + Intronic
1128061621 15:64739048-64739070 ACCCAAAGCCGTGCCTGGAAAGG - Intergenic
1130044246 15:80431532-80431554 TCCCGAAGCCATTCCCGGATGGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132883433 16:2172273-2172295 CCCGGCAGCCGTGCCGGCAGTGG - Exonic
1134150031 16:11797872-11797894 ACAAGAAGCCGTGCCCGCAGCGG - Intergenic
1135892323 16:26368391-26368413 CCCCAAGGCAGTGCCGGGAGAGG + Intergenic
1136146818 16:28320964-28320986 CCCCGAGCCGGTGCCCGGTGCGG + Exonic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1142120283 16:88383495-88383517 GGCCGCAGCCTTGCCCGGAGCGG + Intergenic
1145057933 17:19715304-19715326 CCCCGCACCAGTGCCCCGAGAGG + Intronic
1147375721 17:40021559-40021581 CCCCCAAAACATGCCCGGAGAGG - Intronic
1148157204 17:45431220-45431242 CCCCGAAGCCCGGGCGGGAGCGG - Intronic
1149491230 17:57086119-57086141 CCCTGCAGGCGTGTCCGGAGGGG + Intronic
1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG + Exonic
1161395750 19:4044087-4044109 CCCCGGGGCCGTGGCAGGAGCGG - Intergenic
1161850841 19:6737312-6737334 CCCCGTTTCCGGGCCCGGAGTGG - Intronic
1162752734 19:12838706-12838728 CCCTGCAGCAGTACCCGGAGCGG - Intronic
1165327792 19:35124425-35124447 CCCTGGAGCAGTGCTCGGAGCGG - Intergenic
1166205019 19:41264173-41264195 CGTCGAAGCCGAGGCCGGAGCGG - Intronic
1167217092 19:48171819-48171841 CCCCGCAGCCGTGCCGGGTGGGG - Exonic
1167258271 19:48443584-48443606 CCCCGACGCCGGGCCCGCTGCGG + Exonic
1168589265 19:57619072-57619094 CCCTGAAGCCTTGCCAGGAAGGG + Intronic
925620937 2:5791920-5791942 CCCGGAAGCAGTGCCTGGGGAGG + Intergenic
928158130 2:28894955-28894977 GCCCGAAGCCGAGCCCGGGAAGG - Intronic
928904626 2:36356246-36356268 CCTCGCAGCCGGGCCGGGAGCGG - Exonic
940751225 2:157628867-157628889 CCCCGCAGCCGGGCGGGGAGCGG + Exonic
946361326 2:219220782-219220804 CCCTGAGCCCGTGCCCGAAGAGG - Exonic
946422524 2:219572549-219572571 CCCCGAAGACATGCCCTGGGGGG + Exonic
948045508 2:234940646-234940668 CCCCAAAGCTGAGCCCGCAGCGG + Intergenic
1173918270 20:46725653-46725675 CCCCCAAGCTGGGCCCGGGGAGG + Exonic
1175501646 20:59455146-59455168 CCTCGAAGCCCAGCCCGGAGAGG + Intergenic
1175562663 20:59944444-59944466 AACGGAAGCCGTGCCCCGAGTGG + Exonic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1175989519 20:62780914-62780936 GTCCGAGGCTGTGCCCGGAGTGG - Intergenic
1176074614 20:63242815-63242837 CCCCGATGCCGTCCCCGCACAGG - Intronic
1179300293 21:40102307-40102329 CCCCAAAGCCGTATCCAGAGTGG + Intronic
1180084636 21:45502280-45502302 CCCTGAAACCGTGACCGGGGTGG - Intronic
950196775 3:11014928-11014950 CCCCGCAGCTTTGCCCGGCGGGG - Intronic
950586362 3:13895299-13895321 CCCCCAACCCGAGCCCGGCGGGG + Intergenic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
956414650 3:69013464-69013486 CCGGGAAGCCGCGCCGGGAGCGG + Intronic
962251335 3:133837949-133837971 TCCAGATGCCATGCCCGGAGTGG + Intronic
968908638 4:3465810-3465832 CCCCGGGGCCCTGCCCAGAGAGG - Intronic
984811400 4:183798397-183798419 CCGCGGAGCAGTGCCGGGAGGGG - Intergenic
985616678 5:927048-927070 CCGCGAAGCCGCCCTCGGAGCGG - Intergenic
986661771 5:10065722-10065744 GTCCGGAGCCCTGCCCGGAGGGG - Intergenic
992962784 5:81972263-81972285 CCCCGCAGCCCAGCCCGGCGAGG - Exonic
999133247 5:149300311-149300333 CCACGAAGCTGGGCCCCGAGTGG - Exonic
999461186 5:151758678-151758700 CCTCGCGGCCGGGCCCGGAGTGG - Exonic
1000125298 5:158237731-158237753 CCCTGAAGCTGAGCCCAGAGAGG + Intergenic
1002541164 5:179907523-179907545 CCCGGGAGCCGGGCGCGGAGGGG - Intronic
1009975785 6:70668598-70668620 CCAAGAATCCGAGCCCGGAGTGG - Intronic
1015919292 6:138250649-138250671 CCCAGTAGCCTTGCCAGGAGGGG + Intronic
1018580130 6:165301455-165301477 CCCCGGAGCTCTGCCCCGAGAGG + Intronic
1020006223 7:4784979-4785001 TCCCGAAGCCGCTCCCGGGGCGG - Exonic
1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG + Intergenic
1024471747 7:49773756-49773778 CCCCGAACCCCTCCGCGGAGAGG + Exonic
1024578329 7:50782475-50782497 CCCCGAAGCCCTACCCGGGCCGG - Intronic
1024963942 7:55005264-55005286 CTCCGAGGCCGTGCTCGGGGAGG - Intergenic
1026909195 7:74082958-74082980 CCAGGAAGCAGTGACCGGAGTGG - Intronic
1037547604 8:19939663-19939685 CCCCGAAACGGTCCCCGGAGTGG + Intronic
1045547186 8:103140059-103140081 CCTCCAAGCCTTGCCCAGAGAGG + Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1056569549 9:87803342-87803364 CCCCGACGACGTGACCCGAGAGG - Intergenic
1058021799 9:100098335-100098357 CCCTGAAGCGGTGCCCGGGTTGG - Intronic
1058090662 9:100802094-100802116 CCCCAAAGCCGTGGCCAGAAAGG - Intergenic
1061257405 9:129460640-129460662 CCCCGGAGCCGGGCCCGCGGCGG - Intergenic
1061328096 9:129876115-129876137 CCCCGAATCTGTGCCCAGGGTGG - Exonic
1203760801 EBV:12417-12439 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203761730 EBV:15489-15511 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203762659 EBV:18561-18583 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203763588 EBV:21633-21655 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203764517 EBV:24705-24727 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203765446 EBV:27777-27799 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203766375 EBV:30849-30871 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic
1203767304 EBV:33921-33943 CCCCGAGGAGGCGCCCGGAGTGG + Intergenic