ID: 1049213401

View in Genome Browser
Species Human (GRCh38)
Location 8:141396941-141396963
Sequence CCTTGAGCCAGGTACTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049213396_1049213401 3 Left 1049213396 8:141396915-141396937 CCTGGGCTGTGCTCTCTGGGACC 0: 1
1: 0
2: 5
3: 49
4: 411
Right 1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG No data
1049213393_1049213401 19 Left 1049213393 8:141396899-141396921 CCAGGGAAGGAAACAGCCTGGGC 0: 1
1: 1
2: 1
3: 33
4: 372
Right 1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049213401 Original CRISPR CCTTGAGCCAGGTACTCCTG TGG Intronic
No off target data available for this crispr