ID: 1049215064

View in Genome Browser
Species Human (GRCh38)
Location 8:141404020-141404042
Sequence GAGTGTGCCCCGAGAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 8, 3: 61, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049215064_1049215070 6 Left 1049215064 8:141404020-141404042 CCATCCCCTCTCGGGGCACACTC 0: 1
1: 0
2: 8
3: 61
4: 268
Right 1049215070 8:141404049-141404071 ACAGCCACACCCACTCAGCCAGG No data
1049215064_1049215071 7 Left 1049215064 8:141404020-141404042 CCATCCCCTCTCGGGGCACACTC 0: 1
1: 0
2: 8
3: 61
4: 268
Right 1049215071 8:141404050-141404072 CAGCCACACCCACTCAGCCAGGG No data
1049215064_1049215073 13 Left 1049215064 8:141404020-141404042 CCATCCCCTCTCGGGGCACACTC 0: 1
1: 0
2: 8
3: 61
4: 268
Right 1049215073 8:141404056-141404078 CACCCACTCAGCCAGGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049215064 Original CRISPR GAGTGTGCCCCGAGAGGGGA TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900623692 1:3598720-3598742 GAGTGGGCCCCGGGGGGGGGGGG - Intronic
900810824 1:4800307-4800329 CTGGGAGCCCCGAGAGGGGAAGG + Intergenic
900848828 1:5125896-5125918 GAGAGGCCCCTGAGAGGGGATGG - Intergenic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
902283133 1:15388800-15388822 GACTTTCCCCCTAGAGGGGACGG + Intronic
902393406 1:16119150-16119172 GAGGGTGCCAGGAGTGGGGAGGG + Intergenic
902449069 1:16485200-16485222 GAGTGTCCCACTAGTGGGGATGG + Intergenic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
904218309 1:28942559-28942581 TGGTGTGCCCAGAGAGGGCAAGG - Intronic
904442142 1:30538988-30539010 GAGGTGGCCCCGATAGGGGAGGG - Intergenic
904495234 1:30882713-30882735 GAGTGGGCTCTGAGAGAGGATGG - Intronic
904612956 1:31735345-31735367 GAATGAGCCCCGAGTGGGGTGGG + Intronic
904745192 1:32706408-32706430 TGGTGTGCCCAGGGAGGGGATGG - Intergenic
905207538 1:36351437-36351459 GAGTGGGGCCCCAGAGCGGAGGG + Intronic
905630498 1:39515504-39515526 GAGCCAGCCCCGAGAGGTGAGGG + Intronic
905667263 1:39770685-39770707 GAGCCAGCCCCGAGAGGTGAGGG - Exonic
906280156 1:44547586-44547608 AAGTGTGCACCGAGAGAAGAGGG - Intronic
906462386 1:46044983-46045005 GATTGTGCCCTTAGAGGGCAAGG - Intronic
906511440 1:46412344-46412366 CTGTGGGCCCCGAGAGGGCAGGG - Intronic
906692653 1:47802750-47802772 GGGTGTGCCCGGAGATGGGCGGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908332995 1:63089445-63089467 CAGTTTTCCCCCAGAGGGGAAGG + Intergenic
908477661 1:64505588-64505610 GGGTGTGCCCAGGGAGGGGGAGG - Intronic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
914859090 1:151372002-151372024 GAGCCAGCCCCGAGCGGGGAAGG + Intronic
915273801 1:154774423-154774445 GACTGAGGCCCCAGAGGGGAAGG - Intronic
916659288 1:166906431-166906453 GAAAGTGCTCAGAGAGGGGAAGG + Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920450797 1:206059761-206059783 GAATGTGGCTGGAGAGGGGATGG + Intronic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
921335264 1:214079405-214079427 GAGTGTGCCCTGCGATGGCATGG + Intergenic
922449885 1:225728464-225728486 GAGTGTGCATTGAAAGGGGAGGG + Intergenic
922752562 1:228077368-228077390 GAGTGTGCCCCGTTTGGGAAGGG - Intergenic
923085697 1:230702186-230702208 TATTGTGCCCCGGGAGTGGAAGG - Intergenic
923698804 1:236281361-236281383 GAGTGTGGCGGGAGATGGGACGG - Intronic
923802894 1:237227700-237227722 GAGCGTGCCCTGTGATGGGACGG + Intronic
1064120008 10:12610383-12610405 GAATGTGCCCAGAGAAAGGAGGG - Intronic
1066113947 10:32223055-32223077 GAGTGTGCCCTGTGATGGAATGG + Intergenic
1067526625 10:47043238-47043260 GAGAGAGCCCCCAGAGGAGATGG - Intergenic
1067571057 10:47371184-47371206 GAGAGTGCCCGGGGAGGGGCAGG + Intronic
1069779641 10:70946577-70946599 CAGTGTGCCCTGAAATGGGAAGG + Intergenic
1069874249 10:71551952-71551974 GAGCATTCCCTGAGAGGGGAGGG - Intronic
1070010901 10:72473546-72473568 GAGTGTGCCCTGAGATGGAGCGG - Intronic
1070906676 10:80079141-80079163 GACTGTGACCAGAGAGGGCAAGG - Intronic
1071154479 10:82673152-82673174 GAGTGCGCCCTGAGATGGGATGG + Intronic
1071531384 10:86392421-86392443 GAGAGTGCCCTGGAAGGGGAGGG + Intergenic
1072219578 10:93316241-93316263 GAGTGTGCCAGGAGAGGGAAGGG + Intronic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1075354893 10:121762645-121762667 GCGTGTGCCCTGCGAGGGGATGG + Intronic
1076682493 10:132180405-132180427 GACAGTGCCCAGAAAGGGGAGGG + Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077500517 11:2907963-2907985 GGGCGTGCCCCCAGAGGGGAAGG + Intronic
1078619387 11:12893377-12893399 GAGTGTGCCCTGGGCCGGGAGGG - Intronic
1078626729 11:12964811-12964833 GAGTGCGCCCTGTGAGGGAATGG - Intergenic
1078626755 11:12964975-12964997 GAGTGTGGCCCCAGAAGGCATGG + Intergenic
1079278140 11:19060871-19060893 GAGTGGGGCCGGAGAGGGTAGGG - Intergenic
1081083056 11:38767335-38767357 GAGAGAGCCCTGAGATGGGATGG + Intergenic
1081641674 11:44759963-44759985 GAGTTTGCCAAGTGAGGGGAGGG + Intronic
1081724934 11:45321476-45321498 GAGTGTGCTCCAAGGGAGGAGGG - Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1081927173 11:46840653-46840675 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1083146408 11:60763067-60763089 GAGTGGGCCTCGAGCGGGGGTGG - Intronic
1084219239 11:67667438-67667460 GAGTGGGCCCCGGCAGGGGCTGG - Intronic
1085098374 11:73779469-73779491 GAGTGTGGCTTGACAGGGGAGGG - Intergenic
1085213440 11:74804205-74804227 GAGTGTGCCCTGTGATGGAATGG + Intronic
1085283206 11:75344241-75344263 GAGTGTGTCCTGGGTGGGGATGG - Intronic
1085447003 11:76607625-76607647 GAGTGTGCCCCAAGGGGTGTAGG - Intergenic
1085452685 11:76644911-76644933 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1088510694 11:110570996-110571018 GAGTGTGCCCTGCGTTGGGATGG - Intergenic
1088965784 11:114719784-114719806 GAGTGGGCCCTGAGCGGGTATGG + Intergenic
1089132769 11:116225195-116225217 GTGTGTGCCCACACAGGGGATGG - Intergenic
1089479397 11:118792138-118792160 GAGCGTGCGCCGGGAGAGGACGG + Intergenic
1089599666 11:119605560-119605582 GGGTGTGCGCGGAGAGGTGAGGG + Intergenic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1092598922 12:10037505-10037527 GAGTGTGCCCTGCGATGGGATGG - Intronic
1093656102 12:21695502-21695524 GAGTGTGCCCTGTGATGGGATGG + Intronic
1093949835 12:25152467-25152489 TGGTGTGCCCCAAGAGGGCACGG + Intronic
1094686538 12:32721985-32722007 TGGTGTGCCCAGAGAGGGCACGG - Intronic
1097748275 12:63323982-63324004 GAGTGTAACCAGAGAGGGCATGG + Intergenic
1100890468 12:99120100-99120122 GAGTATGCCCTGCGATGGGAGGG - Intronic
1101571647 12:105959144-105959166 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
1101769639 12:107737168-107737190 TAGTGTCCCCCGAGAGTGGAAGG - Intronic
1101789874 12:107916587-107916609 GAGTGTGCTCTGTGAGGGGATGG + Intergenic
1102951104 12:117032269-117032291 GAGTGTGCCCTGTGATGGGAGGG - Intergenic
1103147624 12:118609309-118609331 GAAGGTGGCCCCAGAGGGGATGG + Intergenic
1103871357 12:124094707-124094729 GAGAGTGCCGCGAGAGTGGCAGG + Intronic
1103937508 12:124484388-124484410 CAGTGTGCCTAGAGAGGGCATGG + Intronic
1103963979 12:124626420-124626442 GGGTGTGCCCCGGGGTGGGAAGG - Intergenic
1106590388 13:31093507-31093529 CAGTGTTCCCCCAAAGGGGATGG + Intergenic
1107304910 13:39007620-39007642 GAGTGTGCCCTGGGATGGGATGG + Intergenic
1107528990 13:41263774-41263796 GCGTGAGCCCAGAGCGGGGATGG + Intergenic
1109189826 13:59310647-59310669 GAGTGTGCCGTGCGATGGGATGG - Intergenic
1109881602 13:68485823-68485845 GAGTGCACCCCGACATGGGACGG - Intergenic
1110019368 13:70450638-70450660 GAGTGTGCCCTGTGATGGGATGG - Intergenic
1111412620 13:87896125-87896147 TAGTGTGCCCAGACAGGGCATGG - Intergenic
1112441519 13:99427493-99427515 GAGTGTGCCCTGAGAGGAAGTGG - Intergenic
1112937187 13:104815702-104815724 GAGTGTGCCCTGGGAGGGAATGG + Intergenic
1115960848 14:38835454-38835476 GAGCGTGCCCAGAGAGGAGAAGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116600212 14:46911947-46911969 GAGTGTGCCCTGCAATGGGATGG - Intronic
1117880283 14:60306481-60306503 GTGTGTGCCCTGAGATGGGATGG - Intergenic
1118031893 14:61826186-61826208 GTGAGTGCCCTGAGATGGGATGG - Intergenic
1119120680 14:72073552-72073574 GAGTGTGCCCTGTGATGGGATGG - Intronic
1119330402 14:73789272-73789294 GAGTGTTCCCAGAGAGTGAAAGG - Intronic
1120156639 14:81100778-81100800 GTGTGTGCCCAGAGAGGGCATGG - Intronic
1120799144 14:88669596-88669618 GACTGAGCTCCTAGAGGGGAGGG + Intronic
1121738446 14:96234954-96234976 GAGTGAGCCCCAAGAGGACAGGG + Intronic
1122308703 14:100781236-100781258 GAGGCTGCACCCAGAGGGGAGGG + Intergenic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125312941 15:38400303-38400325 GACTGTGCCCTGTGATGGGATGG + Intergenic
1126341734 15:47648364-47648386 GAGTGTGCCCTGAGATGGGATGG + Intronic
1128330626 15:66753269-66753291 GGGTGTGCCCAGGGAGGGGTGGG + Intronic
1128509570 15:68305078-68305100 AGGTGGGACCCGAGAGGGGAGGG - Intronic
1128646260 15:69380900-69380922 GAGTGTGCCATGAGTGGAGATGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129258052 15:74345377-74345399 GAGGGTGCTCGGAGAGGTGAGGG - Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1131622191 15:94080116-94080138 GAGCGTGCCCTGTGATGGGATGG - Intergenic
1133801632 16:9090453-9090475 GAGAAAGCCCCGACAGGGGAGGG + Intergenic
1134214379 16:12305458-12305480 AAGTGTGCCCAGAGAAGTGAAGG - Intronic
1135724260 16:24842633-24842655 GAGTGTGCTCTCAGAGGTGATGG - Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG + Intergenic
1137366102 16:47860990-47861012 GAGTGTGCCCTGCGATGGGATGG + Intergenic
1137490763 16:48930593-48930615 GAATGTGCCCTGCGATGGGATGG - Intergenic
1142570358 17:869641-869663 GAGTCTTTCCCGAGTGGGGAGGG - Intronic
1142998162 17:3773581-3773603 GGGTGGCCCCCGAGAGGGCATGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1144002832 17:11071623-11071645 GAGTGTGTCCTGTGACGGGATGG + Intergenic
1145290615 17:21542702-21542724 GAGAGTGCCCTGAGAGAGCAGGG - Intronic
1146062904 17:29616272-29616294 GACTGTGCCCCGCAAGGTGAGGG - Exonic
1146138856 17:30347350-30347372 GATGGTGCCCAGAGAGGGCATGG + Intergenic
1147677909 17:42220055-42220077 CCGTGTGCCCCCAGAGGGGACGG - Intronic
1147688139 17:42299517-42299539 CCGTGTGCCCCCAGAGGGGACGG + Intronic
1148881266 17:50729551-50729573 GAGTATGCCCTGTGATGGGAGGG - Intronic
1149459952 17:56820409-56820431 GAGTGTGCCCTGCGATGGAATGG - Intronic
1149507472 17:57206345-57206367 GAGTGTGCCCTGAGATGGCAGGG - Intergenic
1149883838 17:60320444-60320466 GAGTGTGCCGTGTGATGGGATGG - Intronic
1150005643 17:61467428-61467450 GGGTTTGCTCCAAGAGGGGACGG + Intronic
1150762450 17:67974767-67974789 TGGTGTGCCCAGAGAGGGCATGG - Intronic
1151382437 17:73735098-73735120 GAGTGTGTGGCGAGTGGGGATGG - Intergenic
1151496214 17:74459777-74459799 GACTGTTCCAGGAGAGGGGAGGG - Intergenic
1151733041 17:75922166-75922188 GAGAATGCCCCAAGACGGGATGG - Intronic
1152036261 17:77874937-77874959 GAGGGTGCAGGGAGAGGGGATGG + Intergenic
1152438047 17:80288176-80288198 GCCTCTGCCCCCAGAGGGGATGG - Exonic
1153215528 18:2816929-2816951 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1153389908 18:4544706-4544728 GAGTGTGCCCTGTGATGTGATGG + Intergenic
1154389719 18:13925956-13925978 GCATGTGCTCAGAGAGGGGAAGG - Intergenic
1155125957 18:22875871-22875893 GAGTATGCCCCGCAATGGGATGG + Intronic
1155777508 18:29785685-29785707 GTGTGAGCCCTGTGAGGGGAGGG + Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1161267218 19:3369903-3369925 CATTGTGCTCCGAGAGGGCATGG - Intronic
1161498243 19:4598799-4598821 GAGGGGGCTCCGAGAGGGCAGGG - Intergenic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1163329850 19:16629006-16629028 GACTGTGCCCCCACAAGGGACGG - Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1164405019 19:27936786-27936808 GTGTGTGCCCCAAGTGGGGCTGG + Intergenic
1165160568 19:33813300-33813322 GAGTCTGCCCCGCGTGGAGAGGG - Exonic
1165978068 19:39694407-39694429 GTGTGTGCCCCACGAGGGGGAGG + Intergenic
1167357916 19:49015456-49015478 GAGTGTGGCATGTGAGGGGAGGG - Intronic
1168269257 19:55240886-55240908 GAGGGTGCGCCCACAGGGGATGG + Intronic
925121463 2:1421811-1421833 GAGTAGGAGCCGAGAGGGGAGGG - Intronic
925263445 2:2547677-2547699 GAGGGTGCCAGGAGAGGGGCAGG - Intergenic
926160226 2:10482593-10482615 GCGTGTGCCCACAGAGGGCATGG - Intergenic
926434305 2:12823106-12823128 GAGTATGCCCCGCAATGGGAGGG - Intergenic
927887115 2:26725382-26725404 AAGTGAGCCCAGAGAGGGGTAGG + Intronic
929902684 2:46019353-46019375 GAGTGTGCCCTGCCATGGGATGG + Intronic
930757825 2:54995690-54995712 GAGTGTGCCCTGTGATGGAATGG - Intronic
931591503 2:63888600-63888622 GAGTGTGCCCTGAGATGGGATGG - Intronic
931862639 2:66372285-66372307 GAGTGTGCCCTGTGAAGGAATGG + Intergenic
933048113 2:77564783-77564805 GAGTGTGCCCTGAGATGGGATGG - Intronic
933246135 2:79976795-79976817 GGCTGTGCCCCAAGTGGGGAAGG - Intronic
933800822 2:85959035-85959057 GAGTGTGCCCTGAGATGGGCTGG + Intergenic
934851749 2:97706337-97706359 GAGTGTGTCCTGAGAGGGGATGG + Intergenic
937247131 2:120500712-120500734 GCCTGTGCCCAAAGAGGGGAAGG + Intergenic
938786823 2:134637358-134637380 GAGTGTGCCCTGAGATGAGATGG + Intronic
941317744 2:164015872-164015894 TAGTGTGCCCCGAAAGGGGTTGG + Intergenic
942317963 2:174711800-174711822 GAGTGTGCCCTGTGATGGGTTGG + Intergenic
942595159 2:177585424-177585446 GACTGTCCCCAGAGAGGGCATGG + Intergenic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
944067062 2:195630376-195630398 TAGTGTGCCCAGGGAGGGCATGG - Intronic
944461018 2:199950674-199950696 GCGCGTGCCCTGAGATGGGATGG + Intronic
944699976 2:202238213-202238235 GAGCGAGCCCGGAGAGGGGCGGG + Intronic
945219387 2:207468589-207468611 GAGAGTGCCCAGGGAGGGCATGG - Intergenic
946049504 2:216850179-216850201 GTGTCTCCCCGGAGAGGGGAGGG - Intergenic
946171951 2:217900785-217900807 GAGTGTGCCCTCAGTGTGGATGG - Intronic
946777814 2:223161884-223161906 GAGTGTGTCCCGTGATGGAATGG - Intronic
947727661 2:232410002-232410024 CAGGGTGCACCGGGAGGGGAAGG - Exonic
948460645 2:238128510-238128532 GAGTGAGGCCTCAGAGGGGAGGG - Intronic
1170328341 20:15180586-15180608 AAGTGTTCCCAGAGAGGGCACGG - Intronic
1171200062 20:23233515-23233537 GAGTGTGCGAGGAGAGGTGAGGG + Intergenic
1171486484 20:25489835-25489857 CAGTCTGCCTCCAGAGGGGAGGG - Intronic
1171529509 20:25843619-25843641 GGTTGTGCCCAGGGAGGGGATGG - Intronic
1171547317 20:26012261-26012283 GGTTGTGCCCAGGGAGGGGATGG + Intergenic
1173468912 20:43307024-43307046 GAGTGTTCCCTGAGAGGGCAGGG - Intergenic
1173728433 20:45312516-45312538 GAGTCGGAGCCGAGAGGGGAAGG + Intronic
1173867772 20:46323539-46323561 GTGTGTGCCCCGTGACGGCAAGG - Intergenic
1174424726 20:50423806-50423828 AAGTGAGCCCTGGGAGGGGAGGG + Intergenic
1174914447 20:54640025-54640047 GAGTGTGTCCTGAGACGGGAGGG - Intronic
1175890585 20:62314164-62314186 GAGTGGGCACGGAGAGGCGAGGG + Intronic
1176268628 20:64223823-64223845 GAGCGTGACAGGAGAGGGGAGGG - Intronic
1177611097 21:23449718-23449740 GAGTGTGCCCGGAAATGGAATGG + Intergenic
1178403030 21:32303526-32303548 CAGTGTGGACCCAGAGGGGAAGG + Intronic
1178808658 21:35860776-35860798 GAGAATGCTCCAAGAGGGGATGG - Intronic
1178944117 21:36932025-36932047 GAGTGTGCCCTGTGATGGGAGGG + Intronic
1181489569 22:23253188-23253210 GGCAGTGCCCCGAGAGGGCATGG - Intronic
1182106415 22:27693105-27693127 GTGTGTGCCCTGTGAGGAGAGGG - Intergenic
1182192350 22:28475314-28475336 GAGTGTGCCCTGCCATGGGAGGG - Intronic
1183111678 22:35654110-35654132 TGGTGTGCCCAGAGAGGGCATGG - Intronic
1183378420 22:37478592-37478614 GAGGGTGCCCCAGGAGGGGAAGG + Intronic
1183587269 22:38760201-38760223 CAGTGGGCCCCGGGAGGGCAGGG - Intronic
1184021332 22:41823713-41823735 GAGTGTGCCCTGTGATGGGAGGG - Intronic
1184045837 22:41971726-41971748 GAGTGTGCCCCCACAGGAGACGG + Intergenic
1184154866 22:42660850-42660872 TAGTGTGCCTGGAGAGGGCATGG - Intergenic
1184437778 22:44490046-44490068 GACTGTGCTCCCAGAGGGCAGGG - Intergenic
1184744539 22:46448475-46448497 GAACGTGCCCCAGGAGGGGAAGG + Intronic
1185138674 22:49088360-49088382 GGCTGGGCCCCGAGAGTGGACGG + Intergenic
949903496 3:8839051-8839073 GAGTGGGCCAGGAGATGGGAAGG + Intronic
950475015 3:13209623-13209645 CAGTGTGGTCCGAGAGGGCACGG - Intergenic
950954231 3:17034253-17034275 GAGTGTGCCCTGCGATGGGATGG + Intronic
952978611 3:38717420-38717442 GACTGTGCCCCCAAAGGGGTGGG + Intronic
954134188 3:48574622-48574644 TAGTGTGCCCCCAGAAAGGAGGG + Intronic
955592537 3:60552995-60553017 GAGTGAGTCCTGAGAGGGAATGG + Intronic
956208030 3:66774023-66774045 GAGTGTGCCCCATGATGGGAAGG - Intergenic
957372717 3:79316409-79316431 GAGTATTCCCAGAGAGGGAATGG + Intronic
957827541 3:85468363-85468385 GAGTGTGCCCTGTGGTGGGATGG + Intronic
959104922 3:102054730-102054752 GAGTGTGCCCCGTGATGGGATGG - Intergenic
960456395 3:117878189-117878211 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
961375742 3:126464682-126464704 AAGTGTGCCATGAGAGGGAACGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968065606 3:195757407-195757429 GAGGGTGGCCTGAGAGGGGTGGG - Intronic
968359300 3:198136336-198136358 GAGTGGCCCCTGAGCGGGGAGGG - Intergenic
970212107 4:13720579-13720601 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
970407782 4:15779594-15779616 GAGTGTGCTCGGAGAGGCGAGGG - Intronic
970525447 4:16927469-16927491 GAGTCTGCCTCGAGATGAGAGGG + Intergenic
971022521 4:22551669-22551691 GAGTGTGCCCTGTGATGGGATGG - Intergenic
971363307 4:25956121-25956143 TGGTGTGCCCTGAGAGGGCATGG + Intergenic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
974305020 4:60125072-60125094 AAGTGTGCCCTGCGATGGGATGG - Intergenic
976736542 4:88315814-88315836 GAGTGTGCCCCGTGATGGAATGG + Intergenic
978005411 4:103609749-103609771 GAGAGTGGCAGGAGAGGGGATGG - Intronic
980944414 4:139304849-139304871 GAGCCTGCAGCGAGAGGGGATGG - Intronic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
982931845 4:161418183-161418205 GAGTGTGCCCTGCTATGGGATGG + Intronic
983626279 4:169804876-169804898 GGTGGTGCCCCCAGAGGGGACGG + Intergenic
987620399 5:20332861-20332883 GAGTGTGCTCCGTGATGGGATGG - Intronic
988076600 5:26362653-26362675 GACTGAGCTCCCAGAGGGGAAGG - Intergenic
988478801 5:31612049-31612071 GAGTGAGCCCTGTGATGGGATGG - Intergenic
989669065 5:43892546-43892568 GAGTGTGCCCTGCGATGGGATGG - Intergenic
990412334 5:55553411-55553433 GAATGTGCCCTGTGATGGGATGG + Intergenic
990504512 5:56431240-56431262 GAGTGTGCCCCGCAATGGGATGG + Intergenic
991230240 5:64324285-64324307 GAGTGTGCCCTGTGGTGGGATGG - Intronic
991488596 5:67163365-67163387 GAGTGTCCCAGAAGAGGGGATGG - Exonic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
992851027 5:80807779-80807801 TAGTGTGCCCTGTGATGGGATGG - Intronic
993383905 5:87240940-87240962 GAGTGTGCCCTGTGTTGGGATGG - Intergenic
993673694 5:90792849-90792871 GACTGTGCCCTGCGATGGGATGG - Intronic
994094409 5:95835879-95835901 GAGGGTGCACCGGGAAGGGAGGG + Intergenic
995533249 5:113111409-113111431 GTGTGTGCCCTGCGATGGGATGG + Intronic
998953484 5:147414803-147414825 GAGTGTGCCCTGGGATGGCAGGG - Intronic
999294908 5:150453109-150453131 GTGTGAGCTCTGAGAGGGGAGGG - Intergenic
1000790617 5:165602505-165602527 GAGTGTGCCCTGCGATGGGATGG + Intergenic
1001306146 5:170574748-170574770 GAGTGTGCCCTGCCATGGGATGG - Intronic
1001589307 5:172854621-172854643 GTGTGTGCCCTGCGATGGGAGGG + Intronic
1003092793 6:3118488-3118510 GAGCCAGCACCGAGAGGGGACGG + Intronic
1003391459 6:5716834-5716856 TAGTGTACCCAGAGAGGGCATGG - Intronic
1004076246 6:12346614-12346636 GAGTGTGCCCTGTGATGGGATGG + Intergenic
1004325373 6:14669824-14669846 GCATGAGCCCCGAGAGGGAAAGG + Intergenic
1004813894 6:19291455-19291477 GAGTGTGCCCCGTGATGGGATGG - Intergenic
1006581607 6:35080792-35080814 TAGTGTCCCCCGAGAGGGCGGGG - Intronic
1007706095 6:43792337-43792359 GAATGCGCACCGAGAGTGGAGGG - Intergenic
1007799977 6:44384084-44384106 GAGTGTGCCCTGCAATGGGATGG - Intergenic
1008909127 6:56714531-56714553 GAGTGTGCTCAGACAGGGGCTGG - Intronic
1011785721 6:90842395-90842417 GAGTGTGTCCCATGATGGGATGG + Intergenic
1016278697 6:142386823-142386845 GAGTGTGCCCTGCCATGGGATGG - Intronic
1016284525 6:142458033-142458055 GAGTGTGCCCTGTCATGGGATGG + Intergenic
1017344259 6:153361643-153361665 GAGTGCGCCCTGTGATGGGATGG + Intergenic
1017940939 6:159052398-159052420 GAGTGTGCCCTGCGATGGGGTGG - Intergenic
1018085775 6:160300232-160300254 GAGTGTGGAGCCAGAGGGGAAGG - Intergenic
1019657954 7:2207570-2207592 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1020036520 7:4966634-4966656 TGGTGTGCCCAGAGAGGGCATGG + Intergenic
1020257336 7:6509424-6509446 CACTGTGCCCAGAGAGGGAAAGG - Intronic
1020408442 7:7864446-7864468 GAGTGTGCCCTGTGATGGGATGG - Intronic
1020709258 7:11585744-11585766 GAGTGCACCCTGAGATGGGATGG - Intronic
1021232609 7:18103979-18104001 GAGTGTTCCCTGAGATGGGATGG - Intronic
1021877879 7:25065215-25065237 TGGTGTGCCCAGAGAGGGGATGG + Intergenic
1022792693 7:33704635-33704657 GTGTGTGCACAGCGAGGGGAGGG - Intergenic
1022859192 7:34349008-34349030 GAGTGTGCCCTACGACGGGATGG + Intergenic
1023579544 7:41666742-41666764 GAGTGTACCCTGAGATTGGAGGG + Intergenic
1024851739 7:53725810-53725832 GGGTGGGCCCAGAGAGGGCATGG + Intergenic
1028655462 7:93200916-93200938 GAGTGTGCCCTGAAATGGGATGG - Intronic
1029050286 7:97679790-97679812 TGGTGTGCCCAGGGAGGGGATGG + Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031483601 7:122304888-122304910 GAGTGTGTGCGCAGAGGGGAGGG - Intronic
1031928897 7:127664477-127664499 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1033328505 7:140398547-140398569 CAGCGTGCCCCGCGACGGGAGGG - Exonic
1035010028 7:155706998-155707020 GAGAGAGCACCGAGAGGGGCAGG + Exonic
1035134409 7:156686997-156687019 GAATATGCCCTGGGAGGGGATGG - Intronic
1035221385 7:157408443-157408465 CTGTGTGTCCCCAGAGGGGAGGG - Intronic
1036630627 8:10511736-10511758 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
1036722043 8:11185121-11185143 GAGTGTGCCCTGTGATGGGATGG + Intronic
1037755635 8:21708366-21708388 GAGAGTGCTATGAGAGGGGAAGG + Intronic
1038205798 8:25463840-25463862 CAGTGTGCCCTGTGAGTGGAAGG - Intronic
1038990293 8:32860011-32860033 AAGTGTGCTCCGGCAGGGGAAGG - Intergenic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1043475582 8:80602406-80602428 AATTGTGCCCCAAGATGGGAAGG + Intergenic
1044105913 8:88206508-88206530 GAGTGCGCCCTGCAAGGGGATGG + Intronic
1046679190 8:117149892-117149914 GACTGTGCCCTGTGATGGGAGGG - Intronic
1046881534 8:119314162-119314184 GGGGGTGCCTAGAGAGGGGAAGG + Intergenic
1048797727 8:138166989-138167011 GAGTGCGCCCTGAGATGGGATGG - Intronic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1049276706 8:141723627-141723649 GAGTGTGCAGCGAGAGGGAACGG + Intergenic
1049361826 8:142215650-142215672 GACTGAGCCGAGAGAGGGGAAGG + Intronic
1049549397 8:143249909-143249931 GAGTGCGCTCAGAGAGGAGAAGG + Exonic
1050307186 9:4316661-4316683 GAGTGTGCCCTGAGATGGGACGG + Intronic
1050736238 9:8766367-8766389 GAGTGTACCCTGAGATGGGACGG + Intronic
1053289044 9:36868053-36868075 GCAAGTCCCCCGAGAGGGGAAGG + Intronic
1054966498 9:71033905-71033927 GAATGTGCCCTGTGATGGGATGG - Intronic
1056764703 9:89437545-89437567 CGGTGCGCCCTGAGAGGGGAGGG + Intronic
1057295238 9:93830760-93830782 GAGTGTGACTCGAGAGGGGTGGG - Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1061644992 9:131993915-131993937 GAGTGTGCCCTGTGATGGGATGG + Intronic
1062518180 9:136946367-136946389 GAGAGGGCCCCGAGGGGGCAGGG + Intronic
1062605805 9:137348474-137348496 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1062606209 9:137349981-137350003 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1062743988 9:138200050-138200072 GAGTGGCCCCTGAGCGGGGAGGG - Intergenic
1187278634 X:17838947-17838969 GAGTTGGCCCTGAGAGGGCAGGG - Intronic
1187968036 X:24631977-24631999 GAGTGTGCCCTGCGATGGGATGG + Intronic
1188184487 X:27097184-27097206 GAATATGCCCAGAGAGGGGCAGG + Intergenic
1189687948 X:43585698-43585720 GAGTGTGCCCTGTGATGGGATGG - Intergenic
1190364501 X:49678751-49678773 AAGTGTGCCCTGCGATGGGATGG - Intergenic
1190567295 X:51743696-51743718 GGGTCGGCCCCGAGCGGGGATGG + Exonic
1194664535 X:96663062-96663084 GAGTGTGCCCTGCGATGGGATGG - Intergenic
1196365701 X:114921361-114921383 GAGTGTGCCCTGTGATGGGATGG + Intergenic
1197140768 X:123115162-123115184 GTGTGAGCCCAGAGAGGGCATGG + Intergenic
1197278578 X:124508830-124508852 GGGTCTGCCCAGAGAGAGGAGGG - Intronic