ID: 1049215377

View in Genome Browser
Species Human (GRCh38)
Location 8:141405403-141405425
Sequence TGGGTGGTCTTGGGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049215377_1049215382 -8 Left 1049215377 8:141405403-141405425 CCAGTTTTCCCCAAGACCACCCA 0: 1
1: 0
2: 0
3: 35
4: 308
Right 1049215382 8:141405418-141405440 ACCACCCAAGCAGTGACTTTGGG No data
1049215377_1049215386 12 Left 1049215377 8:141405403-141405425 CCAGTTTTCCCCAAGACCACCCA 0: 1
1: 0
2: 0
3: 35
4: 308
Right 1049215386 8:141405438-141405460 GGGTCCACCCACAGATGCCCTGG No data
1049215377_1049215381 -9 Left 1049215377 8:141405403-141405425 CCAGTTTTCCCCAAGACCACCCA 0: 1
1: 0
2: 0
3: 35
4: 308
Right 1049215381 8:141405417-141405439 GACCACCCAAGCAGTGACTTTGG No data
1049215377_1049215390 27 Left 1049215377 8:141405403-141405425 CCAGTTTTCCCCAAGACCACCCA 0: 1
1: 0
2: 0
3: 35
4: 308
Right 1049215390 8:141405453-141405475 TGCCCTGGTCACTGTGTTGCTGG No data
1049215377_1049215391 28 Left 1049215377 8:141405403-141405425 CCAGTTTTCCCCAAGACCACCCA 0: 1
1: 0
2: 0
3: 35
4: 308
Right 1049215391 8:141405454-141405476 GCCCTGGTCACTGTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049215377 Original CRISPR TGGGTGGTCTTGGGGAAAAC TGG (reversed) Intronic
900706487 1:4083494-4083516 TGGGTGCTCTTCAGGAAAGCAGG + Intergenic
900869071 1:5289079-5289101 TAGGTGGACCTGGAGAAAACAGG - Intergenic
902431933 1:16370070-16370092 TGTGTGATCTTGCGCAAAACAGG - Intronic
902870377 1:19310749-19310771 TGGGGGGTCGGGGGGAAAAGAGG - Intronic
904001450 1:27341281-27341303 TGGGTTGTCTTGGGCACAAGAGG - Intergenic
904160164 1:28517420-28517442 AGAATGGACTTGGGGAAAACGGG - Intronic
904287336 1:29461019-29461041 ATGGTGGCCTTGGGGAAAAGGGG + Intergenic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905210174 1:36368735-36368757 TGGGTGATCTGGGAGAAAAAAGG + Intronic
907017900 1:51035035-51035057 GGGGTCCTCTTGGGGATAACTGG + Intergenic
907217744 1:52880227-52880249 TAGCTGGTCTTGGGAAAAACAGG + Intronic
909131754 1:71745815-71745837 TGGTTGGCTTTGGGAAAAACAGG - Intronic
909450549 1:75793512-75793534 TGGGTGGCCGTGGGGAGCACCGG + Intronic
910187583 1:84560197-84560219 TGGCTGGTTTTGGGGAAAAGAGG - Intronic
910227472 1:84950752-84950774 TGTGTGATCTTGGGCAAACCTGG - Intronic
910625894 1:89306002-89306024 TGGGTGGTGTAGAGGAAAGCTGG - Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911057358 1:93720398-93720420 TGTGTGCTCTTGGGCAAAACAGG + Intronic
914881878 1:151553457-151553479 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
915229202 1:154433140-154433162 TGGGTGGTGTTGGGGGAAGGAGG + Intronic
915772505 1:158442750-158442772 TAGGTGGACTTGAGGAAAAGTGG + Intergenic
916008841 1:160686166-160686188 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
916421784 1:164644503-164644525 GAGGTGGTCTTGGGCAAATCAGG + Intronic
917922955 1:179766141-179766163 TGGCTGGACTTGGGGCAAAATGG - Intronic
918411181 1:184259560-184259582 TGGGTGGGCTTGGTGATATCTGG + Intergenic
918790886 1:188826509-188826531 TAGGTGGTCTCGTGGAAACCTGG - Intergenic
918878428 1:190082035-190082057 AGGGTAGTCTTGGGGACCACCGG + Intergenic
919137997 1:193534582-193534604 TGGCGGGTCTTAGAGAAAACTGG + Intergenic
920872303 1:209805134-209805156 TGGGTGGGATTGGTGAAAGCTGG - Intronic
921359200 1:214314802-214314824 TGGTTGTTTTTGGGGAAAACTGG + Exonic
923527408 1:234783246-234783268 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
924001731 1:239561126-239561148 AGAGTGGTCCTGCGGAAAACAGG - Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
924827189 1:247552052-247552074 TGGCTGGCTTTGGGGAAAAGAGG + Intronic
1063011656 10:2027436-2027458 TGGGAGGGCTTGGGGAAACAAGG + Intergenic
1063516284 10:6699195-6699217 TGGGTGCTCTGGGAGAAGACAGG + Intergenic
1063804602 10:9623956-9623978 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
1065864935 10:29906372-29906394 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1065977946 10:30860071-30860093 TGGTTGGCTTTGGGGAAAAGTGG - Intronic
1066416271 10:35224256-35224278 GGGGTGGTTGTGGGGAAGACTGG + Intergenic
1068611314 10:59063518-59063540 TGGTTGGCTTTGGGGAAAAGGGG - Intergenic
1070951741 10:80436722-80436744 TGGCTGGCTTTGGGTAAAACCGG - Exonic
1072225528 10:93365075-93365097 TGGGTGGAGTTGGGGGAAATTGG - Intronic
1072448182 10:95517549-95517571 TGTGAGGTTGTGGGGAAAACAGG - Intronic
1072797831 10:98369872-98369894 TGGATGGTGTGGGGCAAAACAGG + Intergenic
1073675961 10:105647418-105647440 TGGCTGGCTTTGGGGAAAACAGG - Intergenic
1073926390 10:108521205-108521227 TGGCTGGCTTTGGGGAAAAGAGG - Intergenic
1074580937 10:114718730-114718752 TGGAAGGTCTTGGGCAAAAATGG - Intergenic
1074801940 10:117008699-117008721 GGGGAGGTCTGGGAGAAAACAGG + Intronic
1075884643 10:125888005-125888027 TGAGTGGGCTTAGGGAAAAAAGG - Intronic
1076458790 10:130623952-130623974 TGGGTGGTCCTGTGGACAGCTGG - Intergenic
1077084009 11:738676-738698 TGGCTGGCTTTGGGGAAAAGTGG + Intergenic
1080587371 11:33694268-33694290 TGGGAGCTCTTGTGGAGAACTGG - Intergenic
1080953965 11:37071098-37071120 TGGGGGGTCTTGGGGGAAGAAGG - Intergenic
1081795080 11:45813191-45813213 TGGGTGGGCTTGGTGAAGGCAGG - Intergenic
1083990866 11:66244961-66244983 TGGTGGGTCCTGGGGAAAAACGG - Intergenic
1084065007 11:66699025-66699047 TGGGCCGTCTTCGGGACAACCGG - Exonic
1084607952 11:70183514-70183536 GGGGGGGTCCTAGGGAAAACTGG + Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086464848 11:87042444-87042466 TGGCTGGCTTTGGGGAAAATAGG + Intronic
1087053188 11:93906422-93906444 TGGGAAGACTTGGGGAAGACAGG + Intergenic
1088853131 11:113721792-113721814 TGGGTGGTGTTGGGGAGAGAAGG - Intergenic
1089922097 11:122219089-122219111 TGTGTGGTCTTGGGGGCACCTGG - Intergenic
1091308570 11:134556906-134556928 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1091343740 11:134839404-134839426 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343757 11:134839464-134839486 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343774 11:134839524-134839546 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343791 11:134839584-134839606 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343808 11:134839644-134839666 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343825 11:134839704-134839726 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343842 11:134839764-134839786 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343858 11:134839824-134839846 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343874 11:134839884-134839906 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343923 11:134840069-134840091 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343939 11:134840129-134840151 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343956 11:134840189-134840211 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1091343973 11:134840249-134840271 GGGCTGGGCTTGGGGGAAACGGG - Intergenic
1092065678 12:5588024-5588046 TGGGTGGTCCTGGGGATCTCAGG + Intronic
1093926556 12:24913926-24913948 TGGTTGGCTTTGGGGAAAAGGGG + Intronic
1095663769 12:44769984-44770006 AGAGTGGTCTTGGGGAAATCAGG + Intronic
1096517475 12:52165104-52165126 TGGGGGGACTTGGGCACAACAGG + Intergenic
1097147358 12:56950966-56950988 TGGGTGGCCTTGGGGAGCAGTGG - Intergenic
1097157294 12:57022286-57022308 TGGCTGGCTTTGGGGAAAAGAGG - Intronic
1097180235 12:57167649-57167671 TGGGTTGCCTGGGAGAAAACAGG + Intronic
1098678218 12:73317560-73317582 TGGCTGGCCTTGTGGAGAACAGG - Intergenic
1099115162 12:78614770-78614792 GGGGTGGAATTGGGGAAAGCAGG + Intergenic
1100772221 12:97936099-97936121 TGGGTGGTCTTGATGGAAACGGG - Intergenic
1101104423 12:101425873-101425895 TGGCTGGCTTTGGGGAAAAAGGG + Intergenic
1101417667 12:104522552-104522574 TGAGTGGTCTGGGGGAACCCTGG - Intronic
1102906027 12:116675828-116675850 TACGTGAACTTGGGGAAAACGGG + Intergenic
1102998464 12:117367242-117367264 TGGCTGGTCTCCGGGAAAACAGG - Intronic
1103199246 12:119073157-119073179 TGCCTGGTCTGGGGGAAAGCAGG + Intronic
1103898284 12:124289076-124289098 TGTGTGTTCTTGGGGGAAGCTGG - Intronic
1104012382 12:124940828-124940850 TGGGTGGACGTGGGGAGATCGGG + Intergenic
1104041966 12:125136520-125136542 TGGGTGGACTGGGAGAACACAGG + Intronic
1105967278 13:25396367-25396389 TGGCTGGCCTTGGGGAAAAGGGG + Intronic
1106101581 13:26698070-26698092 TGGGTAGCCTTGGGGGAAAATGG - Intergenic
1106282167 13:28284624-28284646 TAGGTAGTCTTGGGGACAAGGGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107664414 13:42674269-42674291 AGGGTGGTCTTGGGGACCACTGG - Intergenic
1109392470 13:61710283-61710305 TGGGTGGTGGTGGGGGAAATGGG - Intergenic
1110623905 13:77630041-77630063 TGGCTGGCTTTGGGGAAAACAGG + Intronic
1112739909 13:102460898-102460920 TGGAAGGTCTTGGATAAAACCGG + Intergenic
1114999752 14:28407557-28407579 TGAGTGGTCTCGGGGTAAAGAGG + Intergenic
1116563515 14:46415258-46415280 TGTGAGGGCTTGGGGAAAAGAGG - Intergenic
1116585532 14:46698129-46698151 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
1121181903 14:91935355-91935377 TGGGTGGTCGTGGTGCAGACAGG - Intronic
1121473329 14:94173865-94173887 TGGGCGGTCCTGGGAATAACTGG + Intronic
1121585535 14:95060646-95060668 GGGATGGGCTGGGGGAAAACTGG - Intergenic
1126708854 15:51434289-51434311 TTGGTGGTCTTGGGGGAAGTGGG - Intergenic
1127263445 15:57343013-57343035 TGAGTGTTCTTGGGGCAAACAGG + Intergenic
1128415780 15:67444569-67444591 TGGGAGGTGATGGGGACAACAGG + Intronic
1128888567 15:71310750-71310772 TGGTTGGCTTTGGGGAAAAGGGG + Intronic
1130042142 15:80413884-80413906 TGGGTGGTCCAGGCCAAAACAGG - Intronic
1131002082 15:88947048-88947070 TGGCTGGCATTGGGGAAAAGGGG + Intergenic
1131002492 15:88949965-88949987 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
1131072289 15:89473384-89473406 TCTGTGGTCCTGGGGAACACTGG + Intronic
1133066310 16:3209701-3209723 TGGGTGTTCCTGGGGAAACCTGG - Intergenic
1133091128 16:3404450-3404472 AAGGTGCTCTTGGAGAAAACTGG + Exonic
1134188255 16:12100832-12100854 TGGGTGGACTGGGGGACAGCAGG + Intronic
1136366080 16:29809796-29809818 TGGGGGGTGTGGGGGACAACGGG + Intronic
1137465042 16:48700098-48700120 TGTGTGGTCTTGGGCAAATTAGG + Intergenic
1139105675 16:63823926-63823948 TGGGTGGTCTGTGGGCAAAATGG - Intergenic
1139521317 16:67484106-67484128 TGGGCGGTCTTGGAGAAACCTGG - Intergenic
1140317266 16:73911235-73911257 TGAGTGGTTTGGAGGAAAACTGG + Intergenic
1141754677 16:85983303-85983325 TGGTTGGTGTTGGGGAATGCGGG - Intergenic
1141990779 16:87608270-87608292 TGTGGAGGCTTGGGGAAAACAGG - Intronic
1142004687 16:87684128-87684150 TGGGAGGTCCTGGGGGAGACAGG - Exonic
1142163115 16:88569746-88569768 TGGCTGGTCCTGGGGATCACAGG - Intergenic
1142204072 16:88774440-88774462 TGGGTGCTGAAGGGGAAAACAGG + Intronic
1143250183 17:5517745-5517767 TGGGAGGCCTTGGTGAAACCAGG - Exonic
1147662969 17:42127064-42127086 AGGGTGGACCTGGGGAAACCCGG - Intronic
1148870195 17:50654478-50654500 TGCTTGGTCTTGGGCAAACCAGG - Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1152015518 17:77747988-77748010 TGGCTGGCTTTGGGGAAAAGAGG - Intergenic
1152267347 17:79303368-79303390 TGAGTGGTCTTGGGGAAGTGGGG + Intronic
1153673385 18:7434240-7434262 TGTGTAGTCTGGGGGAAAAATGG - Intergenic
1155611979 18:27676270-27676292 TGGGTGGTCATAGGAAAAATGGG - Intergenic
1158032450 18:52982676-52982698 TTGGTGCTCTTGGGGACATCTGG - Intronic
1158172348 18:54614058-54614080 TGGGTAGTCTTTGGGCAAGCAGG - Intergenic
1160548210 18:79676088-79676110 CGGGTGGTTTTGGTGAAACCTGG - Intergenic
1162788011 19:13047812-13047834 TCTGTGGACTTGGGGAAGACAGG + Intronic
1164724113 19:30453736-30453758 TGGGTGGGCCTGGGCAAAACGGG + Intronic
1165915327 19:39255118-39255140 CGGATGGTCTTGGTGAACACCGG + Intergenic
1166226034 19:41396047-41396069 TGGGGAGTATGGGGGAAAACAGG - Intronic
1166343043 19:42150200-42150222 TGGGTGGTCTTGGGGGGCACAGG - Intronic
1166475854 19:43124094-43124116 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
1166963733 19:46515290-46515312 TGGGTGGGATGGGGGAAGACTGG - Intronic
925645994 2:6037455-6037477 TGGGGGCTCTGGGTGAAAACGGG + Intergenic
926300724 2:11600125-11600147 TGTGTGGGCTTGGGGGAAATCGG + Intronic
926602533 2:14861814-14861836 AGGGTTGTCTTGGTGAATACAGG + Intergenic
928876744 2:36048923-36048945 TGGGTGTTATAGGGGAATACTGG + Intergenic
929122964 2:38498582-38498604 TGTGTGTTCTTGGGGAAGAGTGG + Intergenic
931049450 2:58394268-58394290 TGGATGCACTTGGGTAAAACAGG - Intergenic
932011759 2:67985046-67985068 TACATGGTTTTGGGGAAAACTGG + Intergenic
932456151 2:71851273-71851295 TGGGAGGTCTGGGGTAAGACAGG + Intergenic
932484537 2:72075680-72075702 AGGTGGGTCTTGGGGAACACGGG - Intergenic
933065596 2:77791225-77791247 AGGGTTGTCTTGGAAAAAACTGG + Intergenic
933229834 2:79793852-79793874 TGTGTGGTATTGGGGAAAGTTGG - Intronic
933752078 2:85609341-85609363 TTGGGGGTCCTGAGGAAAACAGG + Intronic
936745712 2:115574134-115574156 AGGGTGGAGATGGGGAAAACGGG - Intronic
937914755 2:127093381-127093403 TGGCTGGCTTTGGGGAAAAGGGG - Intronic
939789215 2:146550530-146550552 TGGCTGGCTTTGGGGAAAAGTGG + Intergenic
940122388 2:150281348-150281370 TGGGTGGTGCTGGGGAATACAGG + Intergenic
940944678 2:159602038-159602060 TAGGATGTTTTGGGGAAAACTGG + Intronic
941725119 2:168852323-168852345 TGGGTGTTTTTGCTGAAAACTGG + Intronic
942981073 2:182082787-182082809 AGGGTGGTCTGGGGCAACACAGG - Intronic
942984591 2:182124078-182124100 TAAATGGTGTTGGGGAAAACTGG - Intronic
944144973 2:196497689-196497711 TGGCTGGTGTTGGGGAAAAGGGG - Intronic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
948655398 2:239473717-239473739 TTGGGGGTCTTGGGAAAAATGGG + Intergenic
948850470 2:240703029-240703051 AGGAGGGTCTTGAGGAAAACGGG - Intergenic
1168947297 20:1771904-1771926 TGGATGGCCCTGTGGAAAACTGG - Intergenic
1169894434 20:10487721-10487743 AGGGCGGTCTTGGGCAAAATGGG + Intronic
1170577693 20:17676714-17676736 TGGGTTCTCTGGGGGAAAATGGG - Intronic
1170978364 20:21188094-21188116 TGGCTGGCTTTGGGGAAAATGGG - Intronic
1171083549 20:22213824-22213846 TGGGGGTTCGTGGGGAAGACTGG - Intergenic
1178600931 21:33993618-33993640 TGTGTGATCTTGTGGAACACTGG + Intergenic
1178792021 21:35709464-35709486 TGGGTGCTCTGGGGGAATAGAGG - Intronic
1178976269 21:37223834-37223856 TGGATGGGCTTGGCCAAAACAGG - Exonic
1179088955 21:38245853-38245875 TGGGTGGTCTCAGGGTTAACTGG - Intronic
1179156269 21:38853706-38853728 TGGTAGGGCTTGGGGAAAGCAGG - Intergenic
1180139088 21:45880442-45880464 TGGGTGGTGTGGGAGAAAATAGG + Intronic
1180231000 21:46426714-46426736 GGGGAGGACTTGGGGAAAAGTGG - Intronic
1180284723 22:10733626-10733648 TGAGTGGGCTTAGGGAAAAAAGG - Intergenic
1180634967 22:17257000-17257022 TAGGTGGTCTTGGGGCAGACTGG - Intergenic
1180915380 22:19482464-19482486 AGCGTGCTCCTGGGGAAAACTGG + Intronic
1182794986 22:32985421-32985443 TGGCTGGTGATGGGGAAAAGAGG + Intronic
1183272213 22:36869380-36869402 TGGGTGGCTTTGGGCAAACCTGG - Intronic
1183675460 22:39296867-39296889 GGGGTGGGCTGGGGGAGAACGGG - Intergenic
1183818851 22:40327542-40327564 GGGGAGGTCTGGGGGAAAAGGGG - Exonic
1183984702 22:41563023-41563045 TGGGTGGTGGTGGGGAAACCAGG - Intronic
1185045002 22:48524381-48524403 AGGGTGGCCTTGGGGAATGCAGG - Intronic
949330247 3:2914722-2914744 TGGAAGGGTTTGGGGAAAACTGG - Intronic
949787156 3:7754405-7754427 TGGGATGTGTAGGGGAAAACTGG + Intergenic
949793455 3:7819266-7819288 TCGTTGGTCATGGGGAAAGCAGG + Intergenic
949852866 3:8436446-8436468 TGGGTGGTTATGGGGACATCTGG - Intergenic
950008484 3:9705757-9705779 GGGGTGGTATTGTGGAGAACAGG + Intronic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
950951409 3:17003879-17003901 TGGGTGCTCCTGAGAAAAACTGG - Intronic
951341075 3:21487989-21488011 TGGAAGCTCTTGAGGAAAACTGG - Intronic
951856522 3:27203144-27203166 TGGGTTGTCTGGGGGCAGACTGG - Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952513344 3:34078788-34078810 TGGGTGGTGTGGGGGAGAGCTGG + Intergenic
954104383 3:48401830-48401852 TGGGTGGTGCTGGGGGATACAGG - Intergenic
958137042 3:89507448-89507470 TGGGTGGTCTTAGGGAACCCTGG - Intergenic
961046651 3:123713102-123713124 TGAGTGAACTTGGGGGAAACCGG + Intronic
961585500 3:127918871-127918893 GGGGTAGTGTTGGTGAAAACAGG + Intronic
962119232 3:132544486-132544508 TGGCTGGCTTTGGGGAAAAGAGG + Intergenic
962145486 3:132835637-132835659 TGGGTGGTGTGGGGGAGAGCTGG + Intergenic
964625865 3:158759316-158759338 TGTGTGGTATTGGGGGAAATTGG + Intronic
966159772 3:176955544-176955566 GGGGTGCTGTAGGGGAAAACAGG + Intergenic
966730721 3:183149203-183149225 TGGGTGGGGTGGGGGAAAAGGGG + Intronic
967333953 3:188321748-188321770 TGTGTGGTTTTGGGGGAAAAAGG - Intronic
968508442 4:983318-983340 TGGCTGGCTTTGGGGAAAAGGGG - Intronic
969659772 4:8519755-8519777 TGGGTGGTCTTGGGTCCACCTGG + Intergenic
970384447 4:15542369-15542391 TGGGTGGTGGTGGGGAAACAAGG - Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972227782 4:37033831-37033853 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
973160576 4:47011223-47011245 GGTGAGGTCTTGGGCAAAACAGG - Intronic
973330072 4:48904036-48904058 TGGATGGGCTTAGGGAAAATAGG - Intronic
973724764 4:53764250-53764272 TTGGTGCATTTGGGGAAAACAGG + Intronic
973851282 4:54963857-54963879 TGGATTGTCTTGGAGAAAAAAGG + Intergenic
973930464 4:55788699-55788721 TAAGTGTTCTTGGGGAAAAGAGG - Intergenic
974097601 4:57381599-57381621 GGGGTGGTGATGGGGACAACGGG + Intergenic
974415369 4:61599706-61599728 TGGCTAGCCTTGGGGAAAAGGGG + Intronic
974906484 4:68064549-68064571 TGTGTGGCCTTGGGCAGAACAGG - Intronic
976229962 4:82832325-82832347 TAAATGGTGTTGGGGAAAACTGG + Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
978661418 4:111131478-111131500 TGGGGGCTCTTGGGGGAAAGTGG - Intergenic
979186874 4:117807750-117807772 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
979265459 4:118696900-118696922 TGGGTGTACATGGGGAAAATAGG + Intronic
981356538 4:143795919-143795941 TGGGTGTGATTTGGGAAAACTGG - Intergenic
981368072 4:143926513-143926535 TGGGTGTGATTTGGGAAAACTGG - Intergenic
982666402 4:158269651-158269673 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
983476870 4:168223133-168223155 TTGATGGCCTGGGGGAAAACGGG + Intronic
983754008 4:171311226-171311248 TAAGTGGTGTTGGGGAAAACTGG - Intergenic
983813277 4:172090919-172090941 TAAATGGTGTTGGGGAAAACTGG - Intronic
985041309 4:185894261-185894283 TGGCAGGTGTTGGGGAAAAGTGG + Intronic
985699888 5:1364440-1364462 TGGCTGGGCTTGGGGAATAATGG + Intergenic
986262747 5:6162699-6162721 TGAGTTGTCTTGGGCAACACAGG + Intergenic
986262810 5:6163151-6163173 TGGGTGGTCTTGGATAATTCTGG - Intergenic
987741323 5:21912812-21912834 TGGCTGGCTTTGGGGAAAAAGGG + Intronic
987757198 5:22111392-22111414 GGGTTGGTCTCAGGGAAAACGGG - Intronic
988961145 5:36372873-36372895 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
989671251 5:43919237-43919259 TAAATGGTGTTGGGGAAAACTGG - Intergenic
990008599 5:50969463-50969485 AGGGTGGTCTTAGTGAAAAAGGG + Intergenic
990140928 5:52703173-52703195 TGGGTTGTCTGAGAGAAAACCGG - Intergenic
990248780 5:53891645-53891667 TGGGTGATCTGGGGGAGAATGGG - Intronic
992720509 5:79556489-79556511 TGTGTGATCTTGGGCAAATCAGG - Intergenic
992777756 5:80103297-80103319 TGGCTGGCTTTGGGGAAAAGAGG + Intergenic
995759828 5:115551544-115551566 TGGGTGGTGATGGGGAACTCAGG - Intergenic
995805518 5:116047815-116047837 TGGCTGGCCTTGGAGAAAAGGGG + Intronic
996928212 5:128854770-128854792 TGGGTGTCGTTGTGGAAAACAGG + Intronic
996958314 5:129211971-129211993 TGAATGGTGTTGGGGAGAACTGG + Intergenic
997840869 5:137238045-137238067 TGTGTGATCTTGGGCAAGACTGG + Intronic
999236930 5:150104112-150104134 TGGATGGCCTTGAGGAAACCTGG + Intronic
999334685 5:150705429-150705451 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
999540703 5:152569503-152569525 TGGGATGTTTTGTGGAAAACAGG + Intergenic
999966689 5:156818154-156818176 TGGCTGGCTTTGGGGAAAAGTGG - Intergenic
1001701506 5:173709965-173709987 TGGGTGGTCCATGGGAAAAGGGG + Intergenic
1002373509 5:178772751-178772773 TGGGTGGGCTGGGAGAACACAGG - Intergenic
1002431120 5:179204585-179204607 TTGGTGGTCTTGGGGAGGAGGGG - Intronic
1004287875 6:14339458-14339480 TGGCTGGTCTTGGGGTGATCAGG - Intergenic
1004963804 6:20823975-20823997 TGGATGTTCTTGGGGCAAATGGG + Intronic
1005156956 6:22818593-22818615 TTGGTGGTCTTGGATAATACTGG + Intergenic
1005938997 6:30546917-30546939 TGGAATGTTTTGGGGAAAACTGG - Intronic
1006113752 6:31764262-31764284 TCAGTGGACTTGGGGAGAACTGG - Exonic
1006703082 6:35992951-35992973 TAGGTTGACTTGGGGAAAACAGG + Intronic
1007103879 6:39269984-39270006 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
1007770682 6:44189608-44189630 TGAGAGGTCTGGGGGAAATCAGG - Intergenic
1008309908 6:49954535-49954557 AGGGTGGTCTTGGAGAACTCTGG + Intergenic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1009812936 6:68693097-68693119 TGGTTGGTAGTGTGGAAAACTGG + Intronic
1009813322 6:68698249-68698271 TGGTTGGTAGTGCGGAAAACTGG + Intronic
1011184821 6:84662497-84662519 AGTGTGGGCTTGGGGAAGACAGG + Intergenic
1012902521 6:105022691-105022713 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
1013746268 6:113350082-113350104 TGGTTGGCTTTGGGGAAAAGCGG + Intergenic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1014709645 6:124791767-124791789 TTTGTAGTCTTGGGTAAAACTGG - Intronic
1017619477 6:156281059-156281081 GGGGTGGTCTGGGGACAAACTGG - Intergenic
1017625262 6:156341434-156341456 TGGATGTTTCTGGGGAAAACTGG + Intergenic
1018331192 6:162728490-162728512 TGGGTGGTCTTTGCCAAAAAAGG + Intronic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1019349076 7:544727-544749 TGGGTGGTGTTGGGGAACAGGGG + Intergenic
1020260964 7:6530709-6530731 TGGGTGCTCTTGTGAAAATCGGG - Intronic
1021546497 7:21819065-21819087 TGGGTGGGCATAGGGGAAACTGG + Intronic
1022008172 7:26286047-26286069 TTGGTGGTCCTGGGGAATATTGG + Intergenic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1022379646 7:29847806-29847828 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
1023816740 7:43956329-43956351 TGGGTGGGCTGGGGGACAGCAGG - Intergenic
1027996310 7:85429226-85429248 TGAGTATTCTTGGGGCAAACAGG - Intergenic
1030204108 7:106936084-106936106 AGGTTGGTCTTAGGGAAGACTGG - Intergenic
1030493565 7:110268743-110268765 TGGGTGGTTTTGGAGAAATAAGG - Intergenic
1033239277 7:139663850-139663872 TGGGTGGGCTTCGGGAAAGCAGG - Intronic
1034005370 7:147466420-147466442 TGGCTGGCTTTGGGGAAAAGGGG + Intronic
1035810672 8:2488576-2488598 TGGCTGGTTTTGGGGAAAAGGGG - Intergenic
1036916624 8:12810634-12810656 TGGGTGGTTGTGGGGAAGACTGG - Intergenic
1037450220 8:19009481-19009503 TGGGTTGTCATGGGGAATAAGGG + Intronic
1037995934 8:23352415-23352437 TGGGTGGTTTGGGGAAAAAAGGG - Intronic
1038102281 8:24391201-24391223 AGAGTGATCTTAGGGAAAACAGG - Intronic
1039230989 8:35448001-35448023 TGGGAGGTTTTGGAGAATACTGG - Intronic
1039568678 8:38569029-38569051 TGGCTGGTTTTGGGGAAAAGAGG + Intergenic
1039569462 8:38575483-38575505 TGGCTGGCTTTGGGGAAAATGGG - Intergenic
1039954609 8:42197396-42197418 TGACTGTTCTTGGGGAAAACGGG + Intronic
1040641224 8:49336266-49336288 TGGCTGGCTTTGGGGAAAAGAGG + Intergenic
1040735678 8:50504989-50505011 TGGGTGGGTCTGGGGAAAATAGG - Intronic
1040808925 8:51428489-51428511 TGTGTGGTATTGAGGAATACGGG + Intronic
1042985344 8:74576922-74576944 TGGGTGGTCTAGGGTAAAAATGG + Intergenic
1043957307 8:86375899-86375921 TGGTTAGGCTTTGGGAAAACAGG - Intronic
1045281399 8:100752754-100752776 TGGGTGGTCTTGGATTATACTGG + Intergenic
1045340998 8:101254427-101254449 TGGCTGGCTTTGGGGAAAAGGGG - Intergenic
1045875386 8:106975435-106975457 TGTCTGGCTTTGGGGAAAACGGG + Intergenic
1047562427 8:126002364-126002386 TGAGTGGTATTGGGGACACCCGG - Intergenic
1049178009 8:141206035-141206057 TGGCTGGGCTTTGGGAACACAGG - Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1049271926 8:141700575-141700597 GGGGTGGTCTTGGGGGAAGATGG + Intergenic
1053149109 9:35731898-35731920 TAGGCCGTCTTGGGGAAGACAGG - Intronic
1053367599 9:37534657-37534679 TAGGTGTTCATGGAGAAAACTGG + Intronic
1054739613 9:68791570-68791592 TGAGTCCTCTTGGGGAAAAAAGG + Intronic
1054776945 9:69131858-69131880 GGGGTGGTCTTGGGGATTCCAGG - Intronic
1055871306 9:80883813-80883835 TGGGTATTCTTGGGGCAAAAAGG + Intergenic
1057182582 9:93038005-93038027 GGGGTGGCCTTGGGGAGAAAGGG - Intergenic
1059914167 9:119080050-119080072 TGAATGGTCTTGGGCAAATCGGG - Intergenic
1060555598 9:124505800-124505822 TGGGCGGTCTTGGGGACAAAGGG + Intronic
1061284239 9:129613243-129613265 TGGGTGGACCTGGGGGAGACAGG + Exonic
1061413266 9:130432276-130432298 TGGGTGGTCATGGGTCAGACTGG + Intronic
1061572144 9:131484465-131484487 TGGGTGGTCTTGGGTACATGTGG + Intronic
1185503556 X:616631-616653 TGGCTGGTTTTGGGGAAAAGGGG - Intergenic
1186185472 X:7015950-7015972 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1186319311 X:8407054-8407076 AGGTTACTCTTGGGGAAAACTGG + Intergenic
1186486497 X:9937776-9937798 TGCGTGCTTTTGGGGAAGACGGG + Intronic
1186790994 X:12998594-12998616 TGGGTGGTGTTTGGGGACACTGG + Intergenic
1187524929 X:20045634-20045656 GGGGTGGTCTTGGGGAACTCTGG + Intronic
1188024912 X:25198107-25198129 TGAATGGTGATGGGGAAAACAGG + Intergenic
1188946765 X:36314914-36314936 TGGATGGGTTGGGGGAAAACTGG + Intronic
1189649247 X:43171629-43171651 TGGCTGGTTCTGGGGAAAAGGGG - Intergenic
1193406622 X:81108702-81108724 TGGGTGTTTCTGGGGACAACAGG + Intergenic
1196034066 X:111123798-111123820 GGGGCTGTCTAGGGGAAAACAGG - Intronic
1196257515 X:113539039-113539061 TGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1197334102 X:125190603-125190625 TAGTTGGTCTTGGCTAAAACTGG + Intergenic
1201077220 Y:10197111-10197133 GGGGTGGTGGTGGGGCAAACCGG - Intergenic