ID: 1049217592

View in Genome Browser
Species Human (GRCh38)
Location 8:141415239-141415261
Sequence CAGGCTGGGAAGAGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 8, 3: 63, 4: 518}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049217592_1049217604 11 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217604 8:141415273-141415295 GGGGAGACAGGCCGGAGCCCTGG No data
1049217592_1049217602 -1 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217602 8:141415261-141415283 GCAGCAGGCAGTGGGGAGACAGG No data
1049217592_1049217600 -8 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217600 8:141415254-141415276 CCAGCCTGCAGCAGGCAGTGGGG No data
1049217592_1049217598 -9 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217598 8:141415253-141415275 CCCAGCCTGCAGCAGGCAGTGGG No data
1049217592_1049217603 3 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217603 8:141415265-141415287 CAGGCAGTGGGGAGACAGGCCGG No data
1049217592_1049217596 -10 Left 1049217592 8:141415239-141415261 CCTGGGACCCTCTTCCCAGCCTG 0: 1
1: 0
2: 8
3: 63
4: 518
Right 1049217596 8:141415252-141415274 TCCCAGCCTGCAGCAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049217592 Original CRISPR CAGGCTGGGAAGAGGGTCCC AGG (reversed) Intronic
900135487 1:1115567-1115589 GGGGCAGGGAAGGGGGTCCCTGG - Intronic
900135532 1:1115647-1115669 GGGGCAGGGAAGGGGGTCCCTGG - Intronic
900342312 1:2194874-2194896 CAGGCTGGGATCAGGGCCCCTGG - Intronic
900407140 1:2497744-2497766 CAGGTTGGGACGAAGCTCCCAGG + Intronic
900478239 1:2886181-2886203 CAGGCTGGGGACAGGGCTCCAGG + Intergenic
900479615 1:2891734-2891756 AGGGCTGGGAAGTGGGTTCCAGG + Intergenic
900687351 1:3957186-3957208 GTGGCTGGGAAGGGTGTCCCTGG + Intergenic
900693999 1:3999041-3999063 GAGCCTGGGAGGGGGGTCCCAGG + Intergenic
900931475 1:5740668-5740690 CAGGATGAGATGTGGGTCCCGGG - Intergenic
901225406 1:7610470-7610492 GAGGCTGGGGGGAGGGTCACGGG - Intronic
901236051 1:7668174-7668196 CAGACTGGGAAGTAGGGCCCAGG - Intronic
901310688 1:8267368-8267390 CAGCAGTGGAAGAGGGTCCCAGG + Intergenic
901411070 1:9084570-9084592 CAGGCTGGGATGGTGGGCCCGGG - Intronic
901630203 1:10644242-10644264 CAGGCTGTGAACAGGGGCCAGGG + Intronic
901632053 1:10652896-10652918 GAGCCTGGGAAGGGCGTCCCTGG + Intronic
901637625 1:10677682-10677704 CAGACTGGGAACTGGGCCCCTGG - Intronic
901780942 1:11594120-11594142 CAGGCTGGGAGCAGGGAACCAGG + Intergenic
902219606 1:14956720-14956742 CAAGCAGGGAAGAGGGGCCCTGG + Intronic
902393400 1:16119139-16119161 CTGCCTGGGGAGAGGGTGCCAGG + Intergenic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902701690 1:18176651-18176673 CATGGTGGGAAGAAGGTCACAGG - Intronic
902754072 1:18537614-18537636 CAGGCTGGGAACAGCAGCCCTGG + Intergenic
903221581 1:21872523-21872545 GAGGCGGGGATGAGGGTCGCTGG + Intronic
903654824 1:24942831-24942853 CAGGCTGGGAGGCGGGAGCCCGG - Intronic
903737601 1:25540153-25540175 TAAGCTGGGATGAGAGTCCCTGG - Intergenic
904042663 1:27593422-27593444 CAGGCTGGGACCCAGGTCCCTGG + Intronic
904464236 1:30698534-30698556 CAGGCTGGGAAGCGCAGCCCAGG - Intergenic
904605613 1:31696194-31696216 CAGGCTGGAAAGGGGCACCCAGG + Intronic
904617031 1:31755459-31755481 GAGGCAAGGAAGAGTGTCCCTGG - Intronic
904945074 1:34193250-34193272 CAGGCTGGGAGGAGAGTCTCCGG + Intronic
905269217 1:36775953-36775975 CAGACTGGGGAGAGGGTCCAAGG - Intergenic
905276016 1:36818811-36818833 CAGGCAGGGAAGGGGCTTCCAGG - Intronic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
905604895 1:39288927-39288949 CAGGCTGGGAAGAGTATTACGGG - Intronic
905688999 1:39928953-39928975 CTGGCTGGGCACAGGGTGCCTGG - Intergenic
905770940 1:40637372-40637394 CAGGCTGAGAACAGGGTGCAGGG + Intronic
906029480 1:42706734-42706756 GAGGCTGGGAAGGGAGTCCAGGG - Intergenic
906630191 1:47360866-47360888 CATACTGGGGAGAGAGTCCCTGG + Intronic
906685438 1:47760303-47760325 CTGGCTGGGGAGAGGGTATCTGG + Intergenic
906913768 1:49984611-49984633 CAGGCTGGGAAGTGTGCCTCTGG - Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907452027 1:54551603-54551625 GAGGCTGGGCAGAGGTTCCCAGG - Intronic
907488417 1:54792995-54793017 CAGCCTGGGAGGAGGCTCACAGG + Intronic
910491073 1:87771854-87771876 CAAGCCAGGAAGAGGGCCCCAGG - Intergenic
911449474 1:98045666-98045688 GAAGCTGGGCAGAGGGTCGCTGG - Intergenic
912430694 1:109626976-109626998 CAGGCAGGGCAGAGGTGCCCAGG - Intronic
912469693 1:109898053-109898075 GGGGCAGGGAAGGGGGTCCCAGG - Intergenic
912531244 1:110324440-110324462 TAGGCTGGAAAGAGAGTCCTGGG - Intergenic
914941460 1:152026869-152026891 CAGCCTGGCAGGAGGGACCCCGG - Intergenic
915284181 1:154842388-154842410 CAGGCCGAGGAGAGGGGCCCTGG + Intronic
915526860 1:156481254-156481276 CAGGCAGGGAAGGGGCTTCCAGG + Intronic
916015968 1:160750209-160750231 CAGGCTGGGAGGAAGGTGGCAGG + Intronic
917135432 1:171784375-171784397 CAGGCTGGGGAGTGTGTCTCTGG + Exonic
917460255 1:175223183-175223205 CAGGCAGGGAGGAGGCCCCCAGG - Intergenic
917541866 1:175922273-175922295 CTGGCTGGGAAGAGTGTGTCTGG + Intergenic
917725638 1:177824903-177824925 CAGGCAGGGAGTAGGATCCCTGG + Intergenic
917837685 1:178953922-178953944 AAGGCTGGGAACAAGGCCCCTGG - Intergenic
920052468 1:203172132-203172154 CTGGCTGGGAGGAGGGTCCTGGG + Intronic
920216245 1:204363236-204363258 CAGGCTGGGCAGTGAGACCCCGG - Intronic
921181697 1:212636590-212636612 CAAGCTGGAAGGAGGGACCCTGG - Intergenic
922022193 1:221716493-221716515 CAGGCTGGGAGGAAGGTCTGTGG - Intronic
922225389 1:223641758-223641780 AAGGCGGGGAAGAGGGTTCCAGG - Intronic
922324244 1:224513510-224513532 GAGGCTGGGAAGTGGGGCTCGGG - Intronic
922568625 1:226618607-226618629 CTGGCGGGGGTGAGGGTCCCAGG - Intergenic
922798650 1:228353788-228353810 CAGGATGGGAAGAGGGTCATCGG + Intronic
923079973 1:230643913-230643935 CATGCTGGGGAGAGGTGCCCTGG + Intronic
923107804 1:230868141-230868163 CGGGAGGGGAAGAGGGTCCGCGG + Intronic
923465226 1:234242284-234242306 CAGGCTGGGAAGCGGGTGGAAGG - Intronic
924569254 1:245223127-245223149 CAGGCTGTGACCAGCGTCCCTGG - Intronic
1062972829 10:1661711-1661733 CAGGTTTGGAAGAGGATCCTGGG - Intronic
1062976901 10:1690772-1690794 CAGGCTGGGGAGGGGGTGACAGG - Intronic
1063198283 10:3763269-3763291 CAGGCTGGAAAGATTTTCCCAGG + Intergenic
1063377190 10:5561417-5561439 GAGGGGAGGAAGAGGGTCCCAGG + Intergenic
1064577817 10:16763654-16763676 CAAGCTGGGAAGATGGTTCTGGG - Intronic
1066261882 10:33737315-33737337 CAGGCTGGGCACAGTGTCTCAGG + Intergenic
1066388932 10:34963389-34963411 CCGTCTTGCAAGAGGGTCCCAGG + Intergenic
1066533739 10:36367569-36367591 CAGGCTTGGAAGAGGGCCAACGG + Intergenic
1067683375 10:48453804-48453826 CAGGATGGCAAGAGGCACCCAGG + Intronic
1067773430 10:49144117-49144139 CTGGATGGGAAGAGGCTCCTGGG + Intergenic
1069581785 10:69571748-69571770 GAGGCTGGGGAGATGCTCCCTGG + Exonic
1069729638 10:70602388-70602410 AAAGCTGGAAAGAGGCTCCCTGG - Intronic
1069745966 10:70715301-70715323 CAGGCTGGGAACAGGACCCCAGG + Intronic
1069869657 10:71525545-71525567 CTGGCTGGGAAGAGGCCCCATGG + Intronic
1069890956 10:71652237-71652259 CAGGCTGGGAAGAGGGGGCAGGG - Intronic
1070487384 10:76943674-76943696 CATGCAGGGAAGAGGATTCCAGG + Intronic
1071565955 10:86671368-86671390 CAGGCTGGGTGGTGGCTCCCGGG + Intronic
1071992868 10:91116896-91116918 CAGGCTGGGAAGAGGAGACCTGG - Intergenic
1072757163 10:98029327-98029349 AAAGAAGGGAAGAGGGTCCCAGG - Intronic
1073060751 10:100732118-100732140 CATGCTGGGGAGTGGGTACCAGG - Intergenic
1073149982 10:101304996-101305018 GAGGTGGGGAAGGGGGTCCCAGG - Intergenic
1073313697 10:102563077-102563099 CAGGCTGGTTAGACTGTCCCTGG - Intronic
1073480858 10:103785343-103785365 CTGACTGGACAGAGGGTCCCCGG - Intronic
1074221853 10:111445756-111445778 CAGGCAGGAAAGAGGCTCACGGG + Intergenic
1074258959 10:111832697-111832719 CAGGGTGGGAGGAGGGTGACAGG + Intergenic
1074864239 10:117535637-117535659 GAGGCCGGGAAGAGCGGCCCGGG + Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076889859 10:133278099-133278121 CAGGCTGCCGAGAGGCTCCCAGG + Intergenic
1077162494 11:1120143-1120165 CAGCGTGTGAAGAGGGTCCGGGG + Intergenic
1077329008 11:1975854-1975876 GAGGCTGGCAAGAGGGACTCAGG - Intronic
1077415669 11:2423198-2423220 CTGGCTGGAGAGAAGGTCCCTGG - Intergenic
1077550034 11:3196129-3196151 AAGGCTGTGATGAGGGTCTCAGG + Intergenic
1077850629 11:6072273-6072295 GAGGCTGGGAAGAGGGGTGCAGG + Intergenic
1078444159 11:11391673-11391695 GAGGCTAGGAAGAGGGGGCCAGG + Intronic
1079104151 11:17559687-17559709 CAGGCCAGGAAGATGGTGCCAGG - Intronic
1080508228 11:32939908-32939930 CAGACTAGGAAAAGGGACCCTGG - Intronic
1080553313 11:33393216-33393238 AAGGCTGGGAAGGGCTTCCCAGG - Intergenic
1081868314 11:46371784-46371806 CAGGCTGGGCAGAGGCTGCAGGG + Intronic
1082768765 11:57189313-57189335 AAGGCTGGGTAGTGGGGCCCTGG + Exonic
1083049700 11:59766116-59766138 CAGGCAGACAAAAGGGTCCCAGG - Intronic
1083302480 11:61746175-61746197 CAGGGTGGGCAGGGGCTCCCAGG - Exonic
1083878559 11:65537327-65537349 CAGGCTAGGCAGATGGTGCCTGG + Intronic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1084608674 11:70187055-70187077 CAGGCTGGGAAGAGGGAGATGGG + Intronic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1084634700 11:70383815-70383837 GAGGCAGGGAAGAGGGTGCAGGG - Exonic
1085049905 11:73375126-73375148 TAGGCTGGGATGTGGGACCCTGG + Intergenic
1085123103 11:73980024-73980046 CAGGCAGGGATGAGGGGTCCAGG + Intronic
1086566840 11:88236717-88236739 CAGGCTGGGAGGAGAGAGCCAGG - Intergenic
1089339894 11:117750215-117750237 CAGGCTGGGGACAGAGTCCCTGG - Intronic
1089394763 11:118129348-118129370 AAGGCTGGGGAGAGGGCCCCAGG - Intergenic
1090616587 11:128521485-128521507 GAGGCTGGGTGGAGGGCCCCGGG - Intronic
1091157306 11:133385496-133385518 CAGGCTGGAAAATGGGGCCCTGG - Intronic
1202811987 11_KI270721v1_random:31033-31055 GAGGCTGGCAAGAGGGACTCAGG - Intergenic
1091675857 12:2488768-2488790 CCTGCTGGGAAGAGGGGCCCAGG + Intronic
1091889773 12:4044359-4044381 GAGGCTGGTGAGAGGGTCCCCGG - Intergenic
1092215328 12:6678084-6678106 CAGGATGGGGCGAGGATCCCTGG - Intronic
1094496523 12:30992519-30992541 CAGGCTGGGTAGAGCCGCCCTGG + Exonic
1095992221 12:48043115-48043137 CAGGGTGGTAAGATGGTCTCAGG + Exonic
1096316069 12:50567212-50567234 GAGGCTGGGAAAAGGGTTCATGG - Intronic
1096477592 12:51917825-51917847 AAGGCTGGGAGGAGGCTGCCTGG + Intronic
1096871317 12:54594127-54594149 CAGGCTTGGCAGAGGGTACTGGG + Intergenic
1097018978 12:56006957-56006979 CAAGCTGGGAGGAGGCTTCCAGG - Intergenic
1097192473 12:57226109-57226131 CAGGGTGGGGTGAGGGTGCCAGG - Exonic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1099702782 12:86108890-86108912 TAGGCTGGGAAGTGTGTCTCCGG - Intronic
1100813350 12:98362188-98362210 CTGGCTGGGAAGAAGGTCATGGG - Intergenic
1102006628 12:109593215-109593237 CAGGCTGGTGAGAGGCACCCGGG + Intronic
1103173448 12:118842401-118842423 CAGGATGGGAAGAGTGTTTCAGG - Intergenic
1103261683 12:119594057-119594079 CAGCCTGGGAGGAGAGACCCGGG + Intronic
1104836560 12:131795702-131795724 CAGGCTGGGAAGGGGCTTCGTGG + Intronic
1104913608 12:132252263-132252285 CAGGAAGGGCAGAGAGTCCCAGG + Intronic
1105683592 13:22753816-22753838 GAGACAGGGAAGAAGGTCCCAGG - Intergenic
1105813050 13:24011191-24011213 CAGGCTGGGAGGTGGCACCCAGG - Intronic
1106115210 13:26811847-26811869 CAGCCTGGGAAGAGGGGCCACGG - Intergenic
1106589855 13:31089862-31089884 TAGGCTGGATGGAGGGTCCCCGG + Intergenic
1106788531 13:33130721-33130743 CAAGCTGGAAATATGGTCCCCGG - Intronic
1107016356 13:35710725-35710747 CAGGCTGGGTATAGGGGCTCAGG - Intergenic
1108290942 13:48960142-48960164 CAGCCTTAGAAGAGGGTACCTGG + Intergenic
1108942666 13:55977249-55977271 CAGGCTGTTCAGAGGGTTCCAGG - Intergenic
1111431140 13:88149672-88149694 GAGGCAGGGAAGGGGATCCCAGG + Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1112563633 13:100534315-100534337 CACACTGGGAAGGGTGTCCCAGG - Intronic
1114484881 14:23056648-23056670 CAGGCTTGGAAACGGGTCACCGG + Intronic
1116390764 14:44386205-44386227 CCTGGTGGGAAGGGGGTCCCTGG - Intergenic
1117730368 14:58715960-58715982 CAGGCTTGGCAGAGGGTTTCAGG + Intergenic
1118410506 14:65472244-65472266 AAGGGTGGGAGGAGGGGCCCTGG + Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1119086106 14:71740383-71740405 CAGCCTTGGAAGAGTGACCCAGG - Exonic
1119588260 14:75859078-75859100 GAGGCTGGGAAGATGGACCGTGG + Intronic
1119675523 14:76550751-76550773 CAGGCTGGGAAAAGGGCAGCAGG - Intergenic
1120443080 14:84562751-84562773 GTAGCTGGGAAGAGGGTTCCTGG + Intergenic
1121631508 14:95424373-95424395 CAGGCTTGGAAGGAGGTGCCAGG + Intronic
1122114678 14:99521826-99521848 CACGGTGGGGAGAGGGTACCCGG - Intronic
1122144984 14:99683841-99683863 CAGGCTGGGATGGGGTTTCCGGG + Intergenic
1122286063 14:100653624-100653646 CAGGGTGAGAAGAGGCTCGCTGG - Intergenic
1122389892 14:101373082-101373104 CGGTGTGGGAAGAGGGTTCCAGG + Intergenic
1122430143 14:101635207-101635229 CGGGCTGGGAAGGGCGCCCCTGG - Intergenic
1122477889 14:102024419-102024441 CAGGCTGGGAAGAGATTTCTGGG + Intronic
1122601889 14:102925591-102925613 CAGGCTGGGCTGGGGGTTCCAGG + Intronic
1122718693 14:103710056-103710078 GAAGCTGGCAGGAGGGTCCCCGG + Intronic
1122800455 14:104226852-104226874 GGGGATGGGATGAGGGTCCCTGG + Intergenic
1122817164 14:104319452-104319474 CAGGGTGGGGAGAGGGTAACAGG + Intergenic
1123106848 14:105845770-105845792 AAGGCAGGGAAAAGGGGCCCAGG + Intergenic
1123113416 14:105883256-105883278 GGCGCTGGGAAGAGGTTCCCAGG + Intergenic
1123739259 15:23219441-23219463 CAGGCCTGGCGGAGGGTCCCTGG + Intergenic
1124290478 15:28448397-28448419 CAGGCCTGGCGGAGGGTCCCTGG + Intergenic
1124292759 15:28469151-28469173 CAGGCCTGGCGGAGGGTCCCTGG - Intergenic
1124374099 15:29119856-29119878 AAGGCGGGGAAGCAGGTCCCGGG + Intergenic
1125513668 15:40306424-40306446 CTGACTGGGCAGAGGGTCACAGG - Intronic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1126574688 15:50185188-50185210 CTGGGTGGGAAGAGGGTATCTGG - Intronic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1128612310 15:69084035-69084057 CAGGAGGGGAAAAGGTTCCCTGG + Intergenic
1129521909 15:76191528-76191550 CAGGCTGGGACGGGGGCCCTGGG + Intronic
1129834421 15:78693002-78693024 CAGGGTGGGAACAGGATGCCAGG - Intronic
1131228754 15:90645808-90645830 CAGGCTGAGAAGAGGGGACACGG - Intergenic
1131721190 15:95170589-95170611 CAGGCAGGGCAGCAGGTCCCGGG + Intergenic
1132336811 15:101053082-101053104 CCGGCAGGTAAGCGGGTCCCAGG + Exonic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132936482 16:2483837-2483859 CAGGCTGGGAGCAGGGGCCGGGG + Intronic
1132948062 16:2543546-2543568 CAGGCTGGAAAGAGAGGCCGTGG - Intronic
1132966385 16:2657796-2657818 CAGGCTGGAAAGAGAGGCCGTGG + Intergenic
1133001037 16:2851922-2851944 CAGGCTGGGATGAGGGCCCTGGG + Intergenic
1133126428 16:3649757-3649779 CAGATGGGGCAGAGGGTCCCAGG - Intronic
1133229119 16:4358189-4358211 CAGGCTGGTGGGAGGGTCCCAGG - Intronic
1133236468 16:4389520-4389542 CGGGCTGGGGAGGGGGCCCCAGG - Intronic
1133912748 16:10080754-10080776 TTGGATGGTAAGAGGGTCCCAGG - Intronic
1135748628 16:25038470-25038492 CAGGGTGGGGAGTGGGTACCAGG + Intergenic
1136235098 16:28908835-28908857 CAGTCTGGGAGGAGGGTTCAAGG - Intronic
1136514874 16:30762082-30762104 CAGGCTGGGAAGTGGGAGCGCGG + Exonic
1136708264 16:32209221-32209243 CAGGCCTGGCAGAGGGTCCCTGG - Intergenic
1136759644 16:32720188-32720210 CAGGCCTGGCGGAGGGTCCCTGG + Intergenic
1136808460 16:33150198-33150220 CAGGCCTGGCGGAGGGTCCCTGG - Intergenic
1136895299 16:33992838-33992860 CAGTTTGGGGAGAGGCTCCCAGG + Intergenic
1136913008 16:34159592-34159614 CGCGCAGGGAAGAGGGTTCCGGG + Intergenic
1137587839 16:49674756-49674778 AAGGCAGGGAAGAGGGCACCAGG + Intronic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139422005 16:66854789-66854811 CAGCCTGGGGAGGGGGTCCCAGG - Intronic
1139847100 16:69929019-69929041 CATGCAGTGCAGAGGGTCCCAGG + Intronic
1140266691 16:73427481-73427503 CAAGCTGGGAAGAGGCTATCTGG - Intergenic
1140503867 16:75457523-75457545 AAGGCTGGGATTAGGGTGCCAGG - Intronic
1141111363 16:81273414-81273436 AAGGGTGGGAAAAGGCTCCCTGG - Intronic
1141185591 16:81784805-81784827 CTAGCTGGCAAGGGGGTCCCTGG + Intronic
1141764843 16:86051577-86051599 CGCGCTGGGGAGAGGGTCCCTGG + Intergenic
1142115483 16:88354040-88354062 CAGCCTGGCAACACGGTCCCTGG - Intergenic
1142348818 16:89570679-89570701 CGGGCTGGGGAGGTGGTCCCTGG + Intergenic
1203061798 16_KI270728v1_random:980496-980518 CAGGCCTGGTGGAGGGTCCCTGG + Intergenic
1142472144 17:170475-170497 CAGGCTGGGAGGAGGGGCAGGGG + Intronic
1142639925 17:1279949-1279971 CAGGCTGGGACAAGGGGCTCTGG - Exonic
1143347518 17:6260886-6260908 GAGGCTGGGAACAAGGTCACGGG - Intergenic
1143670533 17:8393033-8393055 CAGGCTGGGCAGCAGGTCCAGGG + Exonic
1143748243 17:9009347-9009369 GAGGCTAGGAAGTGGCTCCCTGG + Intergenic
1143875434 17:9987271-9987293 TGGGGTGGGAAGAGGCTCCCCGG - Intronic
1144022778 17:11251833-11251855 CAGGCTATTAAGAGTGTCCCAGG - Intronic
1144570081 17:16391989-16392011 CAGGCTTGGGAGAGGGCTCCAGG - Intergenic
1145362233 17:22221749-22221771 CAGGCTTGGGAGAGGGCTCCAGG - Intergenic
1145862013 17:28218828-28218850 CAGACTGGGAACAGGGGCACTGG + Intergenic
1145890877 17:28414791-28414813 CTGCCTGGGAAGAGGATCCCAGG + Intergenic
1146655937 17:34635183-34635205 CAGGCAGGGAAGAGTGTTCTGGG - Intronic
1147047805 17:37767710-37767732 CATCTGGGGAAGAGGGTCCCAGG - Intergenic
1147326756 17:39673348-39673370 GAGGCTGGGAGGAGAGTCCGAGG - Intronic
1147340421 17:39750437-39750459 CAGGCTGGGAAGCTGGGACCAGG + Intergenic
1147561677 17:41513170-41513192 CAGGCTGTGAAAAGGGCCCTGGG + Intergenic
1147604826 17:41768655-41768677 GAGGAAGGGAAGAGTGTCCCAGG - Intronic
1148002678 17:44398933-44398955 CAGGCCGGGGAGAAGGTCCTGGG - Exonic
1148054852 17:44787830-44787852 CACGCTGGGAGGAGGGTCTGTGG - Intergenic
1148553463 17:48564290-48564312 CAGCCTGGGCCGAGGGTCCGGGG - Intronic
1148774519 17:50088055-50088077 CAAGCTGGAAAGGGGGACCCAGG + Intronic
1148857019 17:50584429-50584451 AGGGCTGGGAAGAGGGTCCCTGG + Intronic
1150130796 17:62667554-62667576 CAGGGTGGGGAGGGGCTCCCAGG + Intronic
1150815254 17:68387679-68387701 CAGTCTGGGCGGAGGGTGCCGGG - Intronic
1152192461 17:78897044-78897066 CTGCCTGGGTGGAGGGTCCCTGG - Intronic
1152240669 17:79159269-79159291 CAGGTTGGGATGAGAGTCCTGGG + Intronic
1152352726 17:79792440-79792462 CTGGCTGGAAAGAAGGTCCAAGG + Exonic
1152573491 17:81130501-81130523 CAGGCTGCGAGGAGGGGCCGAGG - Intronic
1152661324 17:81543649-81543671 CTGGCTGGGCAGAGGCTGCCTGG - Intronic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1152744441 17:82032327-82032349 CTTGCTGGGCAGAGGGTCCGAGG + Intronic
1152866479 17:82726703-82726725 CTGGGTGGGAAGCGGGTGCCTGG + Intronic
1153625798 18:7021102-7021124 CAGCGTGGGAAGACGGGCCCAGG - Intronic
1153967430 18:10194689-10194711 GATGCTGGTAAGAGGATCCCAGG - Intergenic
1154339997 18:13494976-13494998 CAAGCTGGGAGGCGGGTCTCAGG - Intronic
1155316598 18:24577973-24577995 CAGGGTGGGAGGCGGGTTCCTGG + Intergenic
1155491458 18:26405408-26405430 CAGGCAGCTAAGAGGCTCCCTGG - Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156486450 18:37469047-37469069 TAGGCTGGGAAGATGGCCCCAGG - Intronic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1157488693 18:48107493-48107515 CAGGCTGGAAAGAAGATTCCTGG + Intronic
1157937624 18:51890891-51890913 CAGCCTGGGAAGAGGGCCAGAGG - Intergenic
1158846252 18:61445929-61445951 CAGCCTAGGCTGAGGGTCCCAGG + Intronic
1159019941 18:63135232-63135254 GAGGCAGGGAGGAGGTTCCCTGG - Intronic
1160067456 18:75589063-75589085 CAGGCTGGGCCGAGGTTCCGGGG + Intergenic
1160148578 18:76383488-76383510 CTGGTGGGGAAGAGGGTCCTGGG - Intronic
1160148605 18:76383572-76383594 CTGGTGGGGAAGAGGGTCCTGGG - Intronic
1160148619 18:76383613-76383635 CTGGTGGGGAAGAGGGTCCTGGG - Intronic
1160434300 18:78833613-78833635 CCGGCTGGGGAGAGGGTGCCGGG - Intergenic
1160604904 18:80042855-80042877 CTGGCTGGGAACAGGGGCACAGG - Intronic
1160716719 19:580090-580112 CTGACTGGGAAGACGGTCACAGG + Intronic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161283695 19:3458459-3458481 CAGTCTGAGAGAAGGGTCCCGGG - Intronic
1161515710 19:4695209-4695231 CTGGCAGGGAAGAGGGTCTAGGG - Intronic
1161783815 19:6311012-6311034 TAGGATGAGAAGAGGGTCCCAGG + Intronic
1162001317 19:7746697-7746719 GAGGCTGGGGACGGGGTCCCTGG - Intronic
1162069812 19:8147043-8147065 CAGGCAGGTAAGAGTGTCCCCGG + Intronic
1162333426 19:10045070-10045092 GCGGCTGGGAGGAGGGTCCTGGG - Intergenic
1162334225 19:10050262-10050284 CAGGCTGGGCAGGTGGGCCCAGG + Intergenic
1162782807 19:13015400-13015422 CAGGCTGGGCCTAGGGTCCTGGG - Intronic
1163161262 19:15465474-15465496 GTGGCTGGGAAGAGGGTACAAGG + Intergenic
1163334015 19:16660046-16660068 GAGGCTGGGAAGAGAGAGCCAGG - Intronic
1163337873 19:16685545-16685567 CAGGCTCAGAAGAGCTTCCCTGG - Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164390136 19:27812870-27812892 CAGGCTGGGATGAGGAGGCCTGG - Intergenic
1164576611 19:29408951-29408973 CTGGCTGTGTAGAGGTTCCCAGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164749360 19:30640598-30640620 CAGGCTGGTAAGACGGTGCAGGG - Intronic
1165140988 19:33699754-33699776 CAGGCAGGGCAGTGTGTCCCTGG - Intronic
1165329871 19:35135428-35135450 CAGGGTGGGAGGAGAGGCCCTGG + Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165734914 19:38169947-38169969 CAGGGTGAGATGAGGGGCCCAGG + Intronic
1165893243 19:39127150-39127172 CTGACTGGGGAGAGTGTCCCTGG + Intronic
1165996290 19:39846266-39846288 CAGGCTGGGGTGAGGGTCCGGGG - Intronic
1166104168 19:40589447-40589469 CAGGGTGGGATGGGGGGCCCAGG + Intronic
1167286866 19:48603393-48603415 CTGGCTGGGAGCAGGGCCCCTGG + Intronic
1167436263 19:49480482-49480504 CAGGCTGGGAAGAGGGGGTGAGG + Intronic
1167476243 19:49702901-49702923 GGGGAAGGGAAGAGGGTCCCCGG + Intronic
1167502955 19:49857656-49857678 CGGGGTGGGAAGAGGGGCCCAGG - Intronic
1167526778 19:49989193-49989215 CAGACTAGGAAGAGGGCCCAGGG - Intronic
1167537763 19:50065841-50065863 GAGGCTGGGGTGAGGGTCCAGGG + Intergenic
1167663746 19:50811596-50811618 CAGGCAGGGAAGACCATCCCAGG + Intergenic
1167993671 19:53384303-53384325 CAGGCTGGGAAAAGTGGCTCAGG - Exonic
1168305493 19:55433102-55433124 CAGGCTGGGACGGGGGGCCCGGG + Exonic
925688396 2:6495535-6495557 TGGCCTGGGAAGAAGGTCCCCGG + Intergenic
926245817 2:11121890-11121912 CAGGGTGGGAAGTGGGTGCCTGG - Intergenic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
929673399 2:43898483-43898505 CCTGCTGGGAAGGGGCTCCCCGG + Intronic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
931090810 2:58884007-58884029 CATGCAGGGAAGAGGCTCCGAGG - Intergenic
932002532 2:67897794-67897816 CAGGTTGGGGAGAGGGCCCTGGG - Intergenic
932144549 2:69306569-69306591 GCGGCTGGGAAGCGGGTTCCTGG - Intergenic
932413957 2:71562747-71562769 CAGGAAGGGATGTGGGTCCCTGG + Intronic
934514487 2:94977712-94977734 CAGGTTGGGAAGAGGCTGCGTGG - Intergenic
934650609 2:96089456-96089478 AAGTCTGGGAAGAGGAGCCCCGG - Intergenic
934654555 2:96110348-96110370 GAGGATGGGGAGAGGGTCCAGGG + Intergenic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
934853326 2:97714606-97714628 GAGGCTGGGAAATGTGTCCCAGG + Intronic
935756072 2:106276930-106276952 CAGGTTGGGAAGAGGGTCTTAGG - Intergenic
936013615 2:108941835-108941857 GAGGCTGGGAAGAGGCTGCTGGG - Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936235875 2:110742072-110742094 CACGGTGAGGAGAGGGTCCCAGG + Intronic
936268457 2:111029706-111029728 CCTGCTGGCAAGAGGCTCCCTGG - Intronic
937052397 2:118903164-118903186 GAGGCTGGGAAGAGAGTCTTGGG - Intergenic
939840399 2:147181084-147181106 CAGGCTGGTTGGAGGGTCTCCGG + Intergenic
940215759 2:151301805-151301827 CAGGCTGAGAAGAGTGTGGCAGG + Intergenic
941330637 2:164174298-164174320 CAGGCTGGGAAGAGGAGGCAGGG + Intergenic
941917334 2:170821434-170821456 CAGGTTGGGAAGAGGGGCCAGGG + Intronic
942352031 2:175063018-175063040 CAGACTGGCAAGAGGGAGCCAGG - Intergenic
943172866 2:184426179-184426201 TAGTCGGGGAAGAGGGTCTCTGG - Intergenic
944318277 2:198306885-198306907 CTGGCTGGGACAAGGGTCACAGG - Intronic
944606462 2:201355973-201355995 CAGGGTTGGAACAGGGTCCTGGG + Intronic
944896349 2:204169633-204169655 CCGGCAGGGAAGAGATTCCCTGG - Intergenic
945833296 2:214810302-214810324 TAAGCTCGGATGAGGGTCCCTGG - Intergenic
946016960 2:216611658-216611680 CAGGCTGGGAAGGGCTTTCCAGG - Intergenic
947630939 2:231652648-231652670 CAGCCAGGGCAGAGTGTCCCTGG - Intergenic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948186193 2:236023375-236023397 CAGGATGGGAAGTAGGTTCCAGG + Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948461482 2:238131986-238132008 CCGGCTGGGCAGAGGTGCCCTGG - Exonic
948560809 2:238849601-238849623 CAGGCTGGGAAACGGGTCTGGGG + Intronic
948592403 2:239059858-239059880 CAGGCTGGTAGGTGGGTCCAAGG - Intronic
948861531 2:240754981-240755003 CTGCCTGGGATAAGGGTCCCTGG - Intronic
948910941 2:241002383-241002405 TTGGCTGGGAGGAGGGTCCTGGG + Intronic
948936592 2:241169213-241169235 TTGTCTGGGAAAAGGGTCCCGGG - Intronic
949031538 2:241799544-241799566 CAGGCAGGGGAGAGGGTCCCAGG - Intronic
949047136 2:241877392-241877414 CCTGCAGGGAAGGGGGTCCCAGG - Intergenic
1168877909 20:1184135-1184157 CAGTCTGGGAAAGGGGTTCCTGG - Exonic
1169019917 20:2322063-2322085 GAGTGTGGGAAGATGGTCCCAGG - Intronic
1169799546 20:9500734-9500756 CTGGCTGGGAAGAGCCTCTCAGG - Intergenic
1170857880 20:20074220-20074242 CAGGGTGGAAAGAGGGTTTCGGG - Intronic
1171810664 20:29742839-29742861 CACGCAGGGAAGAGGGTTCCGGG - Intergenic
1171866100 20:30488430-30488452 CGTGCAGGGAAGAGGGTTCCGGG - Intergenic
1172302361 20:33859109-33859131 CCCACTGGGAAGAGGGTTCCTGG + Intergenic
1172539449 20:35699546-35699568 TAGGCTGGGAAGTGGGCCCAAGG - Intronic
1172691479 20:36793400-36793422 CTGGCTGGGGAGAGGGGCTCTGG + Exonic
1172872573 20:38144846-38144868 CAGCCTGGGAAGAGGCTGCGGGG + Intronic
1173040335 20:39456209-39456231 TAGATAGGGAAGAGGGTCCCCGG - Intergenic
1173063143 20:39681196-39681218 TAGGCTGGGGTGAGGGTTCCAGG + Intergenic
1173345112 20:42192230-42192252 CTGGCTGGGAAATGGGTCTCTGG - Intronic
1173403453 20:42744908-42744930 CAGGCTGGGAATGAGGTCCGTGG + Intronic
1173540681 20:43848559-43848581 CATGCTGGGAGCAGGGTCCCAGG + Intergenic
1173551299 20:43934711-43934733 TGGGATGGGAAGAGGGTCCCAGG - Intronic
1174266809 20:49338005-49338027 AAGGCTGAGATGTGGGTCCCAGG + Intergenic
1174315647 20:49698701-49698723 CAGGCTGCCAAGATGGTCCCTGG - Intronic
1174408904 20:50321210-50321232 CAGGCGGAGAAGATGCTCCCAGG + Intergenic
1174865741 20:54134070-54134092 CAGGCAGGGAAGAGTGTTCTGGG + Intergenic
1175292451 20:57885277-57885299 CAGGCTGGGACCAGGGTCGCAGG - Intergenic
1175801323 20:61802692-61802714 CAGGCTGGGAGGCAGCTCCCAGG - Intronic
1175828822 20:61951097-61951119 GAGGGTGGGAAGAGGGGCCCAGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175975153 20:62707391-62707413 CAGGCTGGGGCGGGGGTCGCAGG - Intergenic
1176008596 20:62880124-62880146 CTGGTTGGGATGAGGGCCCCGGG + Exonic
1176045286 20:63089511-63089533 GAGGCTGGGGAGATCGTCCCTGG + Intergenic
1176045296 20:63089551-63089573 GAGGCTGGGGAGATTGTCCCTGG + Intergenic
1176045308 20:63089591-63089613 GAGGCTGGGGAGATCGTCCCTGG + Intergenic
1176045320 20:63089631-63089653 GAGGCTGGGGAGATCGTCCCTGG + Intergenic
1176120612 20:63452955-63452977 CAGGCTGAGGGGAGGGTCCAGGG + Intronic
1176193770 20:63827088-63827110 AAGGCTGGGAGGAGGGTGCCTGG - Intronic
1176269828 20:64230594-64230616 CTGGCTGGGAAGAGGCTCTGTGG - Intronic
1178252808 21:31020742-31020764 CAGGCTGGGTAGAGGGACAACGG + Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1178630584 21:34257152-34257174 AAAACTGGGAAGAGGTTCCCAGG - Intergenic
1178746106 21:35251740-35251762 CAGGAAGGAAAGAGTGTCCCAGG + Intronic
1178756563 21:35355494-35355516 CAGGCAGGGACAAGGGTCTCGGG - Intronic
1180021804 21:45133323-45133345 CATGCTGGGAAGAGGGCCACAGG - Intronic
1180783469 22:18534566-18534588 CAGACTAGGAGGAGGGGCCCAGG - Intergenic
1180786645 22:18551345-18551367 CAGGCAGGGAGGAGGAGCCCTGG + Intergenic
1181127037 22:20708615-20708637 CAGACTAGGAGGAGGGGCCCAGG - Intronic
1181131936 22:20737158-20737180 CAGGCAGGGAGGAGGAGCCCTGG + Intronic
1181240371 22:21473918-21473940 CAGACTAGGAGGAGGGGCCCAGG - Intergenic
1181243560 22:21490866-21490888 CAGGCAGGGAGGAGGAGCCCTGG + Intergenic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1182519827 22:30878974-30878996 GCTGCTGGGAAGAGGGTCACAGG + Intronic
1183248496 22:36711674-36711696 CAGGCTGGGGAGTGGATCCTGGG + Intergenic
1183275273 22:36892534-36892556 CAGCCTGGGAAGAGAGCTCCAGG - Intergenic
1183385155 22:37510048-37510070 CAGGCTGGGTAGCGGGGCTCAGG - Intronic
1183640352 22:39088939-39088961 AAGGCAGGGCAGAGGGACCCTGG - Intergenic
1183742367 22:39675878-39675900 CAGGCTGGGAGGGGGGTCCCTGG + Intronic
1184253118 22:43272079-43272101 CAGGCTGCCAAGTGGGTACCAGG - Intronic
1184550841 22:45203401-45203423 CAGGCTGAGGACAGGGCCCCAGG + Intronic
1184688876 22:46108557-46108579 CAGGAAGGGATGTGGGTCCCCGG - Intronic
1184828976 22:46971988-46972010 CCGGCTGGGAGGAGGGTCAGGGG + Intronic
1184837939 22:47035196-47035218 CAGGCGGGGGTGGGGGTCCCTGG - Intronic
1185098630 22:48825683-48825705 CAGGCAGGGAGGAGGGTCCTGGG + Intronic
1185270918 22:49929075-49929097 CAGCCTGGGAAGGGGGGGCCAGG - Intergenic
1185302586 22:50090200-50090222 GCGGCTGGGAGGCGGGTCCCGGG + Intronic
1185309989 22:50148988-50149010 CAGATTGGGAAGTGGCTCCCAGG + Intronic
950162444 3:10770775-10770797 CAGGCTGGGAGGCGAGCCCCCGG + Intergenic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950718839 3:14868264-14868286 CAGGTGGGGGAGGGGGTCCCTGG - Intronic
952884115 3:38002354-38002376 CAGGCTGGGCAAGGGCTCCCAGG - Intronic
953177374 3:40564249-40564271 GAGGCTGGGAAGAGGGGTGCAGG - Intronic
953843076 3:46405599-46405621 GGGGGTGGGAAGAGTGTCCCAGG + Intergenic
954315256 3:49797806-49797828 CAGGCTGGGATAAGGGTCAGTGG - Intronic
954424975 3:50438458-50438480 GAGGCTGGGCAGAGGGTTCGGGG - Intronic
954441742 3:50525949-50525971 GAGTGTGGGAAGATGGTCCCTGG + Intergenic
954443421 3:50534096-50534118 CAGGCTGGGGAGAGAGACCGGGG - Intergenic
956502643 3:69903407-69903429 CAGGCTCAGAAGAAGGTCTCAGG - Intronic
957624909 3:82644237-82644259 AGAGCTGGGAAGAGGATCCCTGG - Intergenic
958800354 3:98748219-98748241 CAGGTTGGGAATAAGGACCCTGG + Intronic
962676707 3:137763337-137763359 CTGGGTGGGAAGAGGCGCCCAGG + Intergenic
963949393 3:151182492-151182514 CAGGCTGACCAGAGGCTCCCTGG - Intronic
964636239 3:158860618-158860640 CAGGGAGGGAAGAGGGGACCAGG - Intergenic
966010894 3:175075549-175075571 CTGGCTTGGAAGAAAGTCCCAGG - Intronic
968447918 4:661824-661846 CAAGCTGGGAGGAGGACCCCTGG - Intronic
968452545 4:682106-682128 CAGGCTGGGTGGGGGCTCCCGGG + Exonic
968519734 4:1029963-1029985 CAGGCCAGGAAGAGGGGTCCAGG + Intergenic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
968813286 4:2809508-2809530 CAGGCTGGGTACAGGGTCCCTGG + Intronic
969138612 4:5050824-5050846 GAGGCTAGCATGAGGGTCCCTGG - Intergenic
969138673 4:5051142-5051164 CCGGCTGCGAAGGGAGTCCCAGG - Intergenic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
970124564 4:12794256-12794278 CAGGATTGGAAGAGGCTGCCTGG - Intergenic
974950176 4:68577475-68577497 CCGGCTGGGAAGATGGTGGCTGG - Intronic
974958580 4:68673051-68673073 CTGGCTGGGAAGATGGTGGCTGG - Intergenic
976087939 4:81425451-81425473 CTGGCAGGGAAGAGACTCCCAGG + Intergenic
976724530 4:88202674-88202696 CAGGCTGGTCAGAGGTTCTCCGG + Intronic
976929667 4:90550100-90550122 AAAGCAGGGAAGGGGGTCCCAGG + Intronic
979041849 4:115808406-115808428 CAAGCTGGGGAGAGTGTCTCTGG + Intergenic
980230459 4:130040045-130040067 AAGGTTGGGAAGAGGGGCCAGGG + Intergenic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
984792297 4:183625902-183625924 CATGCTGAGAAAAGGGTGCCAGG - Intergenic
984857536 4:184207872-184207894 CAGGCGGTGGAGAGGGGCCCAGG - Intronic
985301874 4:188498639-188498661 CTGGCTTGGAAGATGGTCCTAGG + Intergenic
985542758 5:494416-494438 CCGGCTGTGGAGGGGGTCCCAGG - Intronic
985685727 5:1280616-1280638 CAGCCTGGGACCAGGCTCCCTGG - Intronic
985915974 5:2919574-2919596 CATGCTGGGAAGAGCATCCAAGG + Intergenic
986792915 5:11181033-11181055 CAGGCTGGGCAGAGGCTGACTGG + Intronic
987207825 5:15645417-15645439 CAAGCAGGGAAGAGGCTTCCAGG - Intronic
988918433 5:35919487-35919509 CAGGGTGGAAAGATGGTGCCGGG + Intronic
989007678 5:36833407-36833429 AAGGCAGAGAAGAGGGTACCTGG + Intergenic
990184836 5:53201637-53201659 CTGGCTGGGAAGATGGTGACTGG - Intergenic
990832208 5:59971997-59972019 CAGGTGAGGAATAGGGTCCCAGG - Intronic
992397064 5:76378127-76378149 GTGGCAGGGAAGAGGGTTCCTGG + Intergenic
993077994 5:83259419-83259441 CAGGATGGAATGAGGGTACCTGG + Intronic
995537670 5:113153418-113153440 CAGACTTGGAAGAGGGGTCCAGG + Intronic
997459570 5:134042812-134042834 CAGGCAGGTAAGATGGTGCCTGG - Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998153233 5:139769180-139769202 CATGGTGGGAAGAGGGCTCCAGG + Intergenic
999196260 5:149783605-149783627 CAGGCTGGGAGGAAGATACCTGG + Intronic
999381927 5:151127390-151127412 CATTCTGGGAAGAGGCCCCCAGG + Intronic
1000256186 5:159540844-159540866 GAGATGGGGAAGAGGGTCCCAGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000969115 5:167694335-167694357 CAGGCTGTTAAGAGCTTCCCAGG + Intronic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1001972507 5:175967898-175967920 CAGGCTAGGGAGAGGGGCCGTGG - Intronic
1002244932 5:177875882-177875904 CAGGCTAGGGAGAGGGGCCGTGG + Intergenic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1002518002 5:179773778-179773800 CACACTGGGAAGAGGGCCCCGGG - Intronic
1003051107 6:2782115-2782137 AAGGCGGGGAAGAGGGTAGCAGG - Intronic
1003582627 6:7355718-7355740 CAGGCCGGGAACAGTGTCTCAGG + Intronic
1004914347 6:20318626-20318648 ATGGCTGTGAAGAAGGTCCCAGG + Intergenic
1005464884 6:26103268-26103290 CAGACCAGGAAGAGCGTCCCGGG + Intergenic
1006024762 6:31139734-31139756 CTGGGTGGGAAGAGGGAACCAGG - Exonic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006184782 6:32175663-32175685 CCGACTGGGAAGAGGGTTGCTGG - Intronic
1006642045 6:35494646-35494668 CAGGATGGGGAGAGGAGCCCAGG - Intronic
1006911889 6:37568747-37568769 AAGGCAGGGAAGAGGGAGCCAGG + Intergenic
1006946093 6:37785352-37785374 CAGGCAGGGACGGGGGACCCAGG + Intergenic
1007486585 6:42184749-42184771 CAGGGTAGTAGGAGGGTCCCTGG - Exonic
1007502757 6:42311344-42311366 CAGGGAAGGAAGAGAGTCCCAGG + Intronic
1007615832 6:43179442-43179464 CAAGCTGGCGAGGGGGTCCCAGG - Exonic
1009464497 6:63953150-63953172 CAGGCTGGGATGAGGGGTGCAGG - Intronic
1010878412 6:81138181-81138203 CATGATGGGAAGTGGGTTCCAGG - Intergenic
1011224493 6:85091948-85091970 CATGATGGGTAGAGTGTCCCAGG + Intergenic
1012205184 6:96452540-96452562 CAGGCTGGGAAGTGGGCCTCTGG - Intergenic
1013852910 6:114537591-114537613 CAAGCTTGGAAAAGGATCCCTGG - Intergenic
1016681276 6:146832293-146832315 CAGCCTGGAAAGTGGGTCACTGG + Intergenic
1016857708 6:148687669-148687691 AAGTCTGGGAAGATGGTTCCTGG - Intergenic
1017161106 6:151366699-151366721 CAGGGTGAGAAAAGGCTCCCTGG + Exonic
1017765923 6:157607151-157607173 CATGCTGGGAAGGGGTTCACGGG + Intronic
1017817669 6:158027322-158027344 CGGGGTGGGAAGAGTGTCCTTGG + Intronic
1017823431 6:158064784-158064806 CAGGCCGTGAGGGGGGTCCCTGG - Intronic
1017939118 6:159036030-159036052 CAGGCAGGGGAGAGAGTCCGTGG + Exonic
1018170345 6:161139220-161139242 CAGGCTGCGGAGGGGGTCCCAGG + Intronic
1018174477 6:161167067-161167089 CAGATTGGGAATAGGTTCCCTGG - Intronic
1018484896 6:164231047-164231069 AAGGATGTGAAGACGGTCCCAGG + Intergenic
1019008715 6:168824969-168824991 GAGGATGGGGACAGGGTCCCAGG - Intergenic
1019075163 6:169380878-169380900 CAGGCTGGAAATGGGGTCTCCGG + Intergenic
1019170057 6:170128850-170128872 CAGGCTGCAAGGAGGGTCCCAGG + Intergenic
1019451103 7:1098797-1098819 AAGGCTGGGAAGCGGCTGCCGGG + Intronic
1019605107 7:1906230-1906252 CAGCCTGGGAAGAGGCTGCTTGG - Intronic
1019811313 7:3167157-3167179 CAGGTTGCGAAAAGGGCCCCTGG - Intronic
1019820171 7:3236809-3236831 CAGGCTGGGAACAAGATGCCAGG - Intergenic
1020232515 7:6330746-6330768 CTGGCTGGGAGGAGGGCCCAGGG - Exonic
1020257327 7:6509371-6509393 CAAGCTGGAGAGAGGGTCCTAGG + Intronic
1023028187 7:36070869-36070891 CTGGCTGGGAAGACTGTCCTGGG - Intergenic
1023675653 7:42627310-42627332 CAGACAGGGAAGAGGATCCTAGG - Intergenic
1023997872 7:45173088-45173110 CAGGCTGGGAAGATGCCTCCAGG + Intronic
1024100376 7:46026707-46026729 CAGGTTGGGAAGGGGGTGCTGGG + Intergenic
1024481156 7:49864760-49864782 CATGCTGGGAACTTGGTCCCGGG - Intronic
1024540643 7:50472883-50472905 CAGTCTGGGGAGAAGATCCCTGG - Intronic
1024626125 7:51209718-51209740 GAGGATGGGGAGTGGGTCCCTGG + Intronic
1024779352 7:52828914-52828936 AAGGCTGAGAAGAGGGTTCTTGG + Intergenic
1025012169 7:55406312-55406334 TAGGCTGGCCAGAGCGTCCCTGG + Intronic
1025079141 7:55967043-55967065 CAGGCAGGGATGAGGCTCCCGGG - Intronic
1025605835 7:63039297-63039319 AAGGCTGGGAAGGGGGTTCCAGG - Intergenic
1026618480 7:71928957-71928979 AAAGCAGGGAAGTGGGTCCCTGG - Intronic
1026941797 7:74291301-74291323 CAGGCTGGGAAGGTGGTGCCTGG + Intronic
1028849726 7:95524789-95524811 CAGGCTGGTTAGAGGGTCTCTGG - Intronic
1029016856 7:97324341-97324363 ACAGCTGGGAAGAGGATCCCTGG + Intergenic
1029270246 7:99373290-99373312 CAGGGTGGGAATAGTGTTCCAGG + Intronic
1033609690 7:142953695-142953717 CAGGCTGGTAAGGGCCTCCCAGG - Intronic
1033651248 7:143345664-143345686 CTGGCTGGGGAGGGGCTCCCCGG + Exonic
1034277109 7:149828836-149828858 CAACCTCGGAGGAGGGTCCCAGG - Intergenic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1034566865 7:151922242-151922264 CTGCCTGGGAGGAGGGGCCCAGG + Intergenic
1035241321 7:157531623-157531645 CAGGGTGGGAGGAGAGGCCCAGG - Intergenic
1035261279 7:157663144-157663166 CAGGCTGGGAAGAAGTTCCCCGG + Intronic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1036779114 8:11633686-11633708 AAGTCTGGGAAGGGGGTTCCAGG + Intergenic
1036826512 8:11980459-11980481 CAGGTTGGAAAGTGGGTCTCAGG + Intergenic
1037447485 8:18980963-18980985 CAGGTTGGGAAGAGGGTGTGAGG - Intronic
1039376612 8:37040928-37040950 AAGGCTGGGAAGAGGGTCCTGGG + Intergenic
1039443694 8:37613416-37613438 CAGGCAGGGAAGAAAGCCCCAGG + Intergenic
1041916726 8:63146086-63146108 CTGACTGGGAAGATGGTCACTGG + Intergenic
1042257554 8:66821090-66821112 CAGATTGGGGAGAGGGTGCCGGG + Intronic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1045384476 8:101658108-101658130 CAGGCAGGGAACACTGTCCCAGG + Intronic
1045992815 8:108329652-108329674 ATGGCTGGGAAGATGGTCACTGG + Intronic
1046745942 8:117875909-117875931 CAGGCAGGGAAGAGGGCAACTGG + Intronic
1046799297 8:118407660-118407682 CAGTCAGTGAAGTGGGTCCCAGG + Intronic
1047926702 8:129689304-129689326 CTGGCAGGGAAGAGGATGCCTGG + Intergenic
1048492555 8:134907502-134907524 AAGGGTGGGAAGAGGGTGACAGG - Intergenic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049251857 8:141593454-141593476 CAGGCTGGGAAGGGGCACCCAGG + Intergenic
1049422182 8:142521920-142521942 CAGGCTGGGCAGGTGCTCCCCGG - Intronic
1050566536 9:6889888-6889910 CAGCCTAGAAAGAGGGTGCCAGG - Intronic
1051936712 9:22451253-22451275 CAGGAGGTGAAGAGAGTCCCAGG + Exonic
1052762042 9:32602672-32602694 CATGCTGGGAAGACTGGCCCTGG - Intergenic
1053493282 9:38527465-38527487 CTGGCTGGGAGGAGGGCCCAGGG + Intergenic
1055030338 9:71767715-71767737 AAAGCTGGGAATAGGGTCCAGGG + Intronic
1055077829 9:72235241-72235263 CAGGCTGGAAAGAGGTTCCTGGG + Intronic
1055775632 9:79764431-79764453 CAGGCTTGGATGAGGAGCCCTGG - Intergenic
1057673971 9:97122043-97122065 CTGGCTGGGAGGAGGGCCCAGGG + Intergenic
1059308062 9:113370083-113370105 AAGACTGGGAAGAGGGGCCCCGG - Exonic
1060229715 9:121817830-121817852 CAGGCAGGGAAGTGGCTTCCAGG - Intergenic
1060321762 9:122568411-122568433 CAGGCCGGGAGGAGAGTCCCAGG + Exonic
1060544213 9:124450923-124450945 CAGGCAGGGAAGAGCCTCCTGGG - Intergenic
1060811380 9:126613089-126613111 AAGGCTGGAAAAGGGGTCCCCGG - Intergenic
1060820569 9:126659255-126659277 CAGGTGGTGAGGAGGGTCCCAGG + Intronic
1061387963 9:130301552-130301574 CTGGCTTGGCAGAGGCTCCCAGG + Intronic
1061482462 9:130903713-130903735 CGGGCAGGGCAGAGGGTGCCTGG + Exonic
1061507664 9:131040691-131040713 CAGGCTGGGGAGAGGGGGCAGGG - Intronic
1061550845 9:131333927-131333949 TGGGCTGGGAAGAGGGTGCAAGG + Intergenic
1061749642 9:132769031-132769053 CAGGCTGGGAGGAGGGCCAGGGG + Intronic
1061890835 9:133618279-133618301 GTGGGTGGGAGGAGGGTCCCAGG - Intergenic
1062052702 9:134455826-134455848 CAGGCAGGGAAGGGGGGCCGAGG - Intergenic
1062065977 9:134526437-134526459 CAGGGTGGGTTGAGGGTTCCTGG - Intergenic
1062218203 9:135400353-135400375 CAGGCTGGGGATGGGGTGCCAGG - Intergenic
1062254498 9:135614679-135614701 CAGGCAGGGAGCAGGGTCCCAGG + Intergenic
1062269472 9:135702039-135702061 CAGGCTGGGACGGGGGTGCGGGG - Intergenic
1062386098 9:136312095-136312117 CTGGCTGGGTGGGGGGTCCCCGG - Intergenic
1062610531 9:137371482-137371504 CTTGCTGGGAAGAGGAACCCAGG + Intronic
1062681946 9:137786889-137786911 CAGGCTGGGGAGTGGCTCCGAGG + Intronic
1187076269 X:15938412-15938434 AAGGCTGGGTGGAGTGTCCCAGG - Intergenic
1189243176 X:39541337-39541359 CAGTCTGGAGAGAGGGTCCGAGG - Intergenic
1189853658 X:45201081-45201103 CAGGCTGGGGAGGGGCTCGCTGG + Intergenic
1190319494 X:49171887-49171909 CTGGCCGGGAAGGGGGCCCCGGG - Intergenic
1191779877 X:64853978-64854000 CAGGATGGGATGAGATTCCCAGG + Intergenic
1192318175 X:70067643-70067665 CTGGCTGGGGAAAGGGGCCCTGG + Intergenic
1192452285 X:71252003-71252025 CAGGCTGTGACGAGGGTCTTAGG - Intronic
1192558697 X:72110592-72110614 CAGGCTAGAAGGAGTGTCCCGGG - Intergenic
1192735323 X:73845005-73845027 CAGGCCAGGAAGAGGGGCCTTGG + Intergenic
1193251177 X:79292107-79292129 CAGGCAGGGATGAAGGTGCCTGG - Intergenic
1194014721 X:88605096-88605118 CAGGCTGGTCAGAGGTTCTCTGG - Intergenic
1197239022 X:124103556-124103578 CAGGGTGGGAAGGGGGGCTCAGG - Intronic
1197618154 X:128717442-128717464 CAGGCTGGGAAGTGTGCCTCCGG + Intergenic
1198307667 X:135398961-135398983 CAGGCTGGGAAGTGTGCCTCTGG + Intergenic
1200040458 X:153362315-153362337 CAGGCTGGGAAGCGTGCCTCTGG - Intergenic
1200090525 X:153633829-153633851 CAGGCGGGGAACACGGTGCCAGG + Intergenic