ID: 1049223166

View in Genome Browser
Species Human (GRCh38)
Location 8:141437016-141437038
Sequence GACCCACAGCTCCCCATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223166_1049223175 3 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223175 8:141437042-141437064 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223166_1049223185 23 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223166_1049223174 2 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223174 8:141437041-141437063 GGCCTGGCCCTGCCCGCCGTGGG No data
1049223166_1049223173 1 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223173 8:141437040-141437062 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223166_1049223179 11 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223179 8:141437050-141437072 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223166_1049223180 12 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223166_1049223184 18 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223184 8:141437057-141437079 CCGTGGGGAGCTGTGGGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223166 Original CRISPR GACCCACAGCTCCCCATGGC GGG (reversed) Intergenic
No off target data available for this crispr