ID: 1049223180

View in Genome Browser
Species Human (GRCh38)
Location 8:141437051-141437073
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223157_1049223180 26 Left 1049223157 8:141437002-141437024 CCGGCCTGGCCCTTCCCGCCATG No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223171_1049223180 -10 Left 1049223171 8:141437038-141437060 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223167_1049223180 11 Left 1049223167 8:141437017-141437039 CCGCCATGGGGAGCTGTGGGTCC No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223156_1049223180 27 Left 1049223156 8:141437001-141437023 CCCGGCCTGGCCCTTCCCGCCAT No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223163_1049223180 16 Left 1049223163 8:141437012-141437034 CCTTCCCGCCATGGGGAGCTGTG No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223162_1049223180 17 Left 1049223162 8:141437011-141437033 CCCTTCCCGCCATGGGGAGCTGT No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223161_1049223180 22 Left 1049223161 8:141437006-141437028 CCTGGCCCTTCCCGCCATGGGGA No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223168_1049223180 8 Left 1049223168 8:141437020-141437042 CCATGGGGAGCTGTGGGTCCCGG No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223166_1049223180 12 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223180 8:141437051-141437073 TGCCCGCCGTGGGGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223180 Original CRISPR TGCCCGCCGTGGGGAGCTGT GGG Intergenic
No off target data available for this crispr