ID: 1049223181

View in Genome Browser
Species Human (GRCh38)
Location 8:141437053-141437075
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223181_1049223189 2 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223189 8:141437078-141437100 GGCCTGGCCCTGCCCGCCATGGG No data
1049223181_1049223195 12 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223195 8:141437088-141437110 TGCCCGCCATGGGGAGCTGTGGG No data
1049223181_1049223200 23 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223200 8:141437099-141437121 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223181_1049223199 18 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223199 8:141437094-141437116 CCATGGGGAGCTGTGGGTCCCGG No data
1049223181_1049223194 11 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223194 8:141437087-141437109 CTGCCCGCCATGGGGAGCTGTGG No data
1049223181_1049223188 1 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223188 8:141437077-141437099 CGGCCTGGCCCTGCCCGCCATGG No data
1049223181_1049223190 3 Left 1049223181 8:141437053-141437075 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223190 8:141437079-141437101 GCCTGGCCCTGCCCGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223181 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr