ID: 1049223185

View in Genome Browser
Species Human (GRCh38)
Location 8:141437062-141437084
Sequence GGGAGCTGTGGGTCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223178_1049223185 -10 Left 1049223178 8:141437049-141437071 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223166_1049223185 23 Left 1049223166 8:141437016-141437038 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223171_1049223185 1 Left 1049223171 8:141437038-141437060 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223162_1049223185 28 Left 1049223162 8:141437011-141437033 CCCTTCCCGCCATGGGGAGCTGT No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223176_1049223185 -4 Left 1049223176 8:141437043-141437065 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223172_1049223185 0 Left 1049223172 8:141437039-141437061 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223167_1049223185 22 Left 1049223167 8:141437017-141437039 CCGCCATGGGGAGCTGTGGGTCC No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223177_1049223185 -9 Left 1049223177 8:141437048-141437070 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223163_1049223185 27 Left 1049223163 8:141437012-141437034 CCTTCCCGCCATGGGGAGCTGTG No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223168_1049223185 19 Left 1049223168 8:141437020-141437042 CCATGGGGAGCTGTGGGTCCCGG No data
Right 1049223185 8:141437062-141437084 GGGAGCTGTGGGTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223185 Original CRISPR GGGAGCTGTGGGTCCCGGCC TGG Intergenic
No off target data available for this crispr