ID: 1049223196

View in Genome Browser
Species Human (GRCh38)
Location 8:141437090-141437112
Sequence GACCCACAGCTCCCCATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223196_1049223204 2 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223204 8:141437115-141437137 GGCCTGGCCCTGCCCGCCGTGGG No data
1049223196_1049223209 11 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223209 8:141437124-141437146 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223196_1049223205 3 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223205 8:141437116-141437138 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223196_1049223214 18 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223214 8:141437131-141437153 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223196_1049223215 23 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223215 8:141437136-141437158 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223196_1049223203 1 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223203 8:141437114-141437136 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223196_1049223210 12 Left 1049223196 8:141437090-141437112 CCCGCCATGGGGAGCTGTGGGTC No data
Right 1049223210 8:141437125-141437147 TGCCCGCCGTGGGGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223196 Original CRISPR GACCCACAGCTCCCCATGGC GGG (reversed) Intergenic
No off target data available for this crispr