ID: 1049223211

View in Genome Browser
Species Human (GRCh38)
Location 8:141437127-141437149
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223211_1049223218 1 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223218 8:141437151-141437173 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223211_1049223224 11 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223224 8:141437161-141437183 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223211_1049223230 23 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223230 8:141437173-141437195 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223211_1049223225 12 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223225 8:141437162-141437184 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223211_1049223220 3 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223220 8:141437153-141437175 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223211_1049223229 18 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223229 8:141437168-141437190 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223211_1049223219 2 Left 1049223211 8:141437127-141437149 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223219 8:141437152-141437174 GGCCTGGCCCTGCCCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223211 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr