ID: 1049223226

View in Genome Browser
Species Human (GRCh38)
Location 8:141437164-141437186
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223226_1049223244 18 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223226_1049223234 2 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223234 8:141437189-141437211 GGCCTGGCCCTGCCCGCCGTGGG No data
1049223226_1049223235 3 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223226_1049223239 11 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223239 8:141437198-141437220 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223226_1049223245 23 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223245 8:141437210-141437232 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223226_1049223233 1 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223233 8:141437188-141437210 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223226_1049223240 12 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223240 8:141437199-141437221 TGCCCGCCGTGGGGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223226 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr