ID: 1049223235

View in Genome Browser
Species Human (GRCh38)
Location 8:141437190-141437212
Sequence GCCTGGCCCTGCCCGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223221_1049223235 13 Left 1049223221 8:141437154-141437176 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223223_1049223235 7 Left 1049223223 8:141437160-141437182 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223228_1049223235 -1 Left 1049223228 8:141437168-141437190 CCGTGGGGAGCTGTGGGTCCCGG No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223227_1049223235 2 Left 1049223227 8:141437165-141437187 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223222_1049223235 8 Left 1049223222 8:141437159-141437181 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223217_1049223235 17 Left 1049223217 8:141437150-141437172 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223226_1049223235 3 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223216_1049223235 18 Left 1049223216 8:141437149-141437171 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223235 8:141437190-141437212 GCCTGGCCCTGCCCGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223235 Original CRISPR GCCTGGCCCTGCCCGCCGTG GGG Intergenic
No off target data available for this crispr