ID: 1049223241

View in Genome Browser
Species Human (GRCh38)
Location 8:141437201-141437223
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223241_1049223254 11 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223241_1049223260 23 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223241_1049223250 3 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223250 8:141437227-141437249 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223241_1049223248 1 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223248 8:141437225-141437247 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223241_1049223249 2 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223249 8:141437226-141437248 GGCCTGGCCCTGCCCGCCGTGGG No data
1049223241_1049223259 18 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223241_1049223255 12 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223255 8:141437236-141437258 TGCCCGCCGTGGGGAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223241 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr