ID: 1049223244

View in Genome Browser
Species Human (GRCh38)
Location 8:141437205-141437227
Sequence CCGTGGGGAGCTGTGGGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223227_1049223244 17 Left 1049223227 8:141437165-141437187 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223236_1049223244 -9 Left 1049223236 8:141437191-141437213 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223221_1049223244 28 Left 1049223221 8:141437154-141437176 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223228_1049223244 14 Left 1049223228 8:141437168-141437190 CCGTGGGGAGCTGTGGGTCCCGG No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223222_1049223244 23 Left 1049223222 8:141437159-141437181 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223223_1049223244 22 Left 1049223223 8:141437160-141437182 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223232_1049223244 -5 Left 1049223232 8:141437187-141437209 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223226_1049223244 18 Left 1049223226 8:141437164-141437186 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223231_1049223244 -4 Left 1049223231 8:141437186-141437208 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223244 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223244 Original CRISPR CCGTGGGGAGCTGTGGGTCC CGG Intergenic
No off target data available for this crispr