ID: 1049223254

View in Genome Browser
Species Human (GRCh38)
Location 8:141437235-141437257
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223237_1049223254 16 Left 1049223237 8:141437196-141437218 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223231_1049223254 26 Left 1049223231 8:141437186-141437208 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223241_1049223254 11 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223232_1049223254 25 Left 1049223232 8:141437187-141437209 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223242_1049223254 10 Left 1049223242 8:141437202-141437224 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223238_1049223254 15 Left 1049223238 8:141437197-141437219 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223236_1049223254 21 Left 1049223236 8:141437191-141437213 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223243_1049223254 7 Left 1049223243 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
Right 1049223254 8:141437235-141437257 CTGCCCGCCGTGGGGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223254 Original CRISPR CTGCCCGCCGTGGGGAGCTG TGG Intergenic
No off target data available for this crispr