ID: 1049223256

View in Genome Browser
Species Human (GRCh38)
Location 8:141437238-141437260
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223256_1049223263 1 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223263 8:141437262-141437284 CGGCCTGGCCCTGCCCGCCGTGG No data
1049223256_1049223275 23 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223275 8:141437284-141437306 GGGAGCTGTGGGTCCTGGCCTGG No data
1049223256_1049223270 12 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223270 8:141437273-141437295 TGCCCGCCGTGGGGAGCTGTGGG No data
1049223256_1049223274 18 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223274 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG No data
1049223256_1049223269 11 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223269 8:141437272-141437294 CTGCCCGCCGTGGGGAGCTGTGG No data
1049223256_1049223265 3 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223265 8:141437264-141437286 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223256_1049223264 2 Left 1049223256 8:141437238-141437260 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223264 8:141437263-141437285 GGCCTGGCCCTGCCCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223256 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr